LOCUS       NM_001348947            2908 bp    mRNA    linear   VRT 08-APR-2024
DEFINITION  Gallus gallus NLR family pyrin domain containing 3 (NLRP3), mRNA.
ACCESSION   NM_001348947
VERSION     NM_001348947.2
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 2908)
  AUTHORS   Liu,Z., Du,J., Wang,Y., Song,H., Lu,L., Wu,R. and Jin,C.
  TITLE     The NLRP3 molecule is responsible for mediating the pyroptosis of
            intestinal mucosa cells and plays a crucial role in salmonellosis
            enteritis in chicks
  JOURNAL   Mol Immunol 168, 47-50 (2024)
   PUBMED   38422886
  REMARK    GeneRIF: The NLRP3 molecule is responsible for mediating the
            pyroptosis of intestinal mucosa cells and plays a crucial role in
            salmonellosis enteritis in chicks.
            Review article
REFERENCE   2  (bases 1 to 2908)
  AUTHORS   Wang,J., Yin,Y., Zhang,Q., Deng,X., Miao,Z. and Xu,S.
  TITLE     HgCl2 exposure mediates pyroptosis of HD11 cells and promotes M1
            polarization and the release of inflammatory factors through
            ROS/Nrf2/NLRP3
  JOURNAL   Ecotoxicol Environ Saf 269, 115779 (2024)
   PUBMED   38056124
  REMARK    GeneRIF: HgCl2 exposure mediates pyroptosis of HD11 cells and
            promotes M1 polarization and the release of inflammatory factors
            through ROS/Nrf2/NLRP3.
REFERENCE   3  (bases 1 to 2908)
  AUTHORS   Tang,H., Finn,R.D. and Thomas,P.D.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   4  (bases 1 to 2908)
  AUTHORS   Ye,J., Yu,M., Zhang,K., Liu,J., Wang,Q., Tao,P., Jia,K., Liao,M.
            and Ning,Z.
  TITLE     Tissue-specific expression pattern and histological distribution of
            NLRP3 in Chinese yellow chicken
  JOURNAL   Vet Res Commun 39 (3), 171-177 (2015)
   PUBMED   26246158
  REMARK    GeneRIF: that NLRP3 gene is highly variable between mammalian and
            avian.
REFERENCE   5  (bases 1 to 2908)
  AUTHORS   Burge,S., Kelly,E., Lonsdale,D., Mutowo-Muellenet,P., McAnulla,C.,
            Mitchell,A., Sangrador-Vegas,A., Yong,S.Y., Mulder,N. and Hunter,S.
  TITLE     Manual GO annotation of predictive protein signatures: the InterPro
            approach to GO curation
  JOURNAL   Database (Oxford) 2012, bar068 (2012)
   PUBMED   22301074
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 2908)
  AUTHORS   Caldwell,R.B., Kierzek,A.M., Arakawa,H., Bezzubov,Y., Zaim,J.,
            Fiedler,P., Kutter,S., Blagodatski,A., Kostovska,D., Koter,M.,
            Plachy,J., Carninci,P., Hayashizaki,Y. and Buerstedde,J.M.
  TITLE     Full-length cDNAs from chicken bursal lymphocytes to facilitate
            gene function analysis
  JOURNAL   Genome Biol 6 (1), R6 (2005)
   PUBMED   15642098
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAENSK010000212.1.
            
            On Dec 3, 2021 this sequence version replaced NM_001348947.1.
            
            Sequence Note: The RefSeq transcript was derived from the reference
            genome assembly. The genomic coordinates were determined from
            transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: HQ730914.1, SRR13267654.37719.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA103992290, SAMEA103992323
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-297               JAENSK010000212.1  628969-629265       c
            298-1960            JAENSK010000212.1  626830-628492       c
            1961-2050           JAENSK010000212.1  626524-626613       c
            2051-2221           JAENSK010000212.1  626257-626427       c
            2222-2395           JAENSK010000212.1  625939-626112       c
            2396-2563           JAENSK010000212.1  625685-625852       c
            2564-2908           JAENSK010000212.1  625264-625608       c
FEATURES             Location/Qualifiers
     source          1..2908
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="5"
                     /map="5"
     gene            1..2908
                     /gene="NLRP3"
                     /gene_synonym="CIAS1; Nalp3; NLRPL"
                     /note="NLR family pyrin domain containing 3"
                     /db_xref="CGNC:51875"
                     /db_xref="GeneID:423021"
     exon            1..297
                     /gene="NLRP3"
                     /gene_synonym="CIAS1; Nalp3; NLRPL"
                     /inference="alignment:Splign:2.1.0"
     CDS             21..2798
                     /gene="NLRP3"
                     /gene_synonym="CIAS1; Nalp3; NLRPL"
                     /note="cold autoinflammatory syndrome 1; NACHT, LRR and
                     PYD domains-containing protein 3; NACHT, LRR and PYD
                     domains-containing protein 12; NLR family pyrin domain
                     containing-like"
                     /codon_start=1
                     /product="NACHT, LRR and PYD domains-containing protein 3"
                     /protein_id="NP_001335876.2"
                     /db_xref="CGNC:51875"
                     /db_xref="GeneID:423021"
                     /translation="

MAGEESTILLEALEGLTLEDFQEFKKKLPHTDIKGGWNIGRDELEKVTHPSSLISYMGDSYGEGAAMDIAISLFEEMNQRDLAEKILDEKVKEYKQKYTEHVAREFLQYKEANSCLGENLSVRDRYTNLTIARKSWDQHGDEPGDVSSDTVTTQTLFEPSKDGQVPLITVLVGASGMGKTMTIRKVMMEWVEGTLCTQFDYVFCIDCKELSFSKEVSMVDLISKCCPQQRMPAGRILGNPEKILFIFDSFEALGLPLAQPKDELSTDPTEAKPLETTLLSLLRRTVLPESSVLIATRPAALQSLGQCLEGKHYVEILGFSPAAREEYFHRYFGNDNKADVAFRFTRGNEVLYSLCVIPVMSWTVCTVLERELYERNQLLACSKTTTQMIMFYLSWLMKHRVSNAWQNLQQFLHKLCSLAADGIWKHKVLFEEKEIEDQGLNQPQLLSLFLNEKGLEKGTDHVNVYSFSHLHLQELFAAMFYVLEDQDGMVSDSRILAKDVNMLLESYHTSRMDLNVTVRLLFGLVNPKSVEYAGEGIGCRISLQPREDLLRWLQTRPRGTSHPREVMKIEDLDTFHLLFETNEKSFVQSVLGSFTGIALQDVKLTLYDQAALCFCIKQWAGLLSVTLRSCSFHQQHHRQEPAKGLPRQSWQQEELHSPLHPLCQALGHPGSSLQSLRLQWCGLTEGDSGALGTLLATLPSLVHLELGDGALGDDGVRMLCAGLRQPGCQLRVLRLRYTHLTSACCQDLAVALGTSTCLEELDLSFSAGLRDDGVKLLCEGLQHSGCQLRALRLGSCSLTGACCQALVAWLRHSHGLKCLDLSDTELGAGATLLLQHLRHHSCTLQTLGLSTSTLSKDALQELAALRALKPSLKITDLLEHEAPETGAMARLTFQRSVWAGRGAAVRGRKGLPSSRAAPPHSRSLC"

     misc_feature    36..284
                     /gene="NLRP3"
                     /gene_synonym="CIAS1; Nalp3; NLRPL"
                     /note="Pyrin Death Domain found in ASC; Region:
                     Pyrin_ASC-like; cd08321"
                     /db_xref="CDD:260033"
     misc_feature    528..1025
                     /gene="NLRP3"
                     /gene_synonym="CIAS1; Nalp3; NLRPL"
                     /note="NACHT domain; Region: NACHT; pfam05729"
                     /db_xref="CDD:428606"
     misc_feature    1251..1421
                     /gene="NLRP3"
                     /gene_synonym="CIAS1; Nalp3; NLRPL"
                     /note="NOD2 winged helix domain; Region: NOD2_WH;
                     pfam17779"
                     /db_xref="CDD:465501"
     misc_feature    1425..1787
                     /gene="NLRP3"
                     /gene_synonym="CIAS1; Nalp3; NLRPL"
                     /note="NLRC4 helical domain HD2; Region: NLRC4_HD2;
                     pfam17776"
                     /db_xref="CDD:465499"
     misc_feature    <1995..2651
                     /gene="NLRP3"
                     /gene_synonym="CIAS1; Nalp3; NLRPL"
                     /note="protein phosphatase 1 regulatory subunit 42;
                     Region: PPP1R42; cl42388"
                     /db_xref="CDD:455733"
     misc_feature    2037..2120
                     /gene="NLRP3"
                     /gene_synonym="CIAS1; Nalp3; NLRPL"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275381"
     misc_feature    2121..2207
                     /gene="NLRP3"
                     /gene_synonym="CIAS1; Nalp3; NLRPL"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275381"
     misc_feature    2208..2285
                     /gene="NLRP3"
                     /gene_synonym="CIAS1; Nalp3; NLRPL"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275381"
     misc_feature    2292..2381
                     /gene="NLRP3"
                     /gene_synonym="CIAS1; Nalp3; NLRPL"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275381"
     misc_feature    2382..2465
                     /gene="NLRP3"
                     /gene_synonym="CIAS1; Nalp3; NLRPL"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275381"
     misc_feature    2466..2549
                     /gene="NLRP3"
                     /gene_synonym="CIAS1; Nalp3; NLRPL"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275381"
     exon            298..1960
                     /gene="NLRP3"
                     /gene_synonym="CIAS1; Nalp3; NLRPL"
                     /inference="alignment:Splign:2.1.0"
     exon            1961..2050
                     /gene="NLRP3"
                     /gene_synonym="CIAS1; Nalp3; NLRPL"
                     /inference="alignment:Splign:2.1.0"
     exon            2051..2221
                     /gene="NLRP3"
                     /gene_synonym="CIAS1; Nalp3; NLRPL"
                     /inference="alignment:Splign:2.1.0"
     exon            2222..2395
                     /gene="NLRP3"
                     /gene_synonym="CIAS1; Nalp3; NLRPL"
                     /inference="alignment:Splign:2.1.0"
     exon            2396..2563
                     /gene="NLRP3"
                     /gene_synonym="CIAS1; Nalp3; NLRPL"
                     /inference="alignment:Splign:2.1.0"
     exon            2564..2908
                     /gene="NLRP3"
                     /gene_synonym="CIAS1; Nalp3; NLRPL"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

gtgattttccatctcccgtgatggcaggagaagaaagcaccatcctcttagaagcactggaaggtctcacactcgaagacttccaagagttcaagaagaagctgccacacactgatatcaaaggaggctggaacatcggcagggatgagctggagaaggtcacccatccttcctcactcatcagttatatgggcgacagctatggggaaggtgctgctatggacattgccatcagtctgtttgaggagatgaaccagagggaccttgctgaaaaaatccttgatgagaaggtgaaagagtataagcagaaatacacagagcacgtggccagagagttcctgcagtacaaagaggcgaattcctgcctaggggagaacctgtctgtgcgcgaccgctacaccaacctgaccatagccaggaagtcttgggatcagcacggagatgagcctggagatgtcagctctgacactgtcaccacacaaacactctttgaacccagcaaagatggccaggtgcctctgatcacggtgctggtgggtgcctctggcatggggaagacgatgacgatcaggaaggtgatgatggagtgggtggaagggaccctctgcacacagtttgactatgtcttctgcatagactgcaaggagctttccttttccaaagaagtgagcatggtggacctgatttcaaaatgctgccctcaacagcgaatgccggctggaaggattttgggtaacccggagaagatcctgttcatctttgatagctttgaggccctgggattgcccttggctcagccgaaggacgagctgagcactgaccccacggaagccaaaccactggaaaccaccctgctgagcttgctcaggagaacagtcctccctgagtcctctgtgctcattgccacgagaccagcagctctccagagcctggggcagtgcctggagggcaagcattatgtggaaatcctggggttttcaccagctgcaagggaggagtatttccacaggtattttgggaatgacaataaagcagatgtggccttcaggtttaccaggggaaatgaggtcctctacagcttgtgtgtcatccccgtcatgagctggactgtctgcaccgtccttgagcgagagctgtacgagaggaatcagctccttgcgtgctctaagaccaccacacagatgatcatgttctacctctcctggttaatgaagcatagagtcagcaatgcctggcagaacctgcagcagttcctgcacaagctttgctccttggctgctgacggcatctggaagcacaaggtcctctttgaggagaaggaaattgaggaccaaggcctgaatcagccacagctcctctccctcttcctcaatgagaaaggtttggagaaaggcacagaccatgtgaatgtctacagcttcagccacctgcacctccaggagctcttcgcagcgatgttttacgtcctggaggaccaggacggaatggtcagtgactcacggatccttgcaaaggacgtgaatatgttgttagaaagctaccacacatctaggatggatttaaacgtcacagtgaggctcctgtttggtctggtgaaccccaagtcagtagagtacgcgggtgaaggaatcgggtgcagaatttcattgcaacctcgggaagatctgctgaggtggcttcagacacggcccagaggcacttcccatccccgcgaagtgatgaagattgaggatttggacaccttccaccttttattcgagacaaacgaaaaaagctttgtgcagagcgtgttgggcagtttcacaggaatagccttgcaggacgtcaagctgacactgtatgaccaggcggctctttgcttctgcatcaagcagtgggccgggctgctcagtgtcaccctccggagctgctctttccaccagcagcatcacaggcaggagccagccaagggcttgccccggcagagctggcagcaggaggagctgcactcacctctgcacccgctgtgccaggccctggggcacccaggcagctcactccagagcctcaggctgcagtggtgcgggctgacggagggtgacagcggggcgctggggacgctgctggccacgctccccagcctggtccacttggagctgggcgacggagcgctgggtgatgatggtgtgaggatgctctgtgccgggctgcgccaacccggctgccagctgcgtgtcctgcggctgcggtacacccacctcaccagtgcctgctgccaggacctcgccgtggcactgggcaccagcacgtgcctggaggagctggacctgtccttcagcgccgggctgcgggatgacggcgtgaagctgctgtgtgaggggctccagcacagcggctgccaactgcgggcgctgcggctggggagctgcagcctgaccggcgcctgctgccaggccctggtggcatggctcaggcacagccacggcctgaagtgcctggacctgagtgacaccgagctgggagctggagccacgctgctgctgcagcatctccgccatcacagctgcacgctgcagacgctggggctgagcacttctacactgagcaaggatgcgctgcaggagctggctgccctgcgggcgctgaagcccagcttgaagatcacagacctactggaacacgaggccccagagacgggtgccatggcacgactgaccttccagcgcagcgtctgggcaggcaggggggcagctgttcgggggcgaaaggggctcccctcctctcgggcagcccctccccacagcaggagcctgtgctagctgggccgtgccctgctcttcctgctggtaacattccccccggtgccgaaggaaggccagcaagtttccaagcagtttgagggcttgaataaaaaagggacgttcacact

//