ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-01-18 02:45:57, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NM_001305103 2675 bp mRNA linear VRT 30-APR-2025
DEFINITION Gallus gallus ubiquitin specific peptidase 13 (USP13), mRNA.
ACCESSION NM_001305103 XM_426842
VERSION NM_001305103.2
KEYWORDS RefSeq.
SOURCE Gallus gallus (chicken)
ORGANISM Gallus gallus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
Phasianidae; Phasianinae; Gallus.
REFERENCE 1 (bases 1 to 2675)
AUTHORS Burge,S., Kelly,E., Lonsdale,D., Mutowo-Muellenet,P., McAnulla,C.,
Mitchell,A., Sangrador-Vegas,A., Yong,S.Y., Mulder,N. and Hunter,S.
TITLE Manual GO annotation of predictive protein signatures: the InterPro
approach to GO curation
JOURNAL Database (Oxford) 2012, bar068 (2012)
PUBMED 22301074
REMARK Publication Status: Online-Only
REFERENCE 2 (bases 1 to 2675)
AUTHORS Boardman,P.E., Sanz-Ezquerro,J., Overton,I.M., Burt,D.W., Bosch,E.,
Fong,W.T., Tickle,C., Brown,W.R., Wilson,S.A. and Hubbard,S.J.
TITLE A comprehensive collection of chicken cDNAs
JOURNAL Curr Biol 12 (22), 1965-1969 (2002)
PUBMED 12445392
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
JAENSK010000240.1.
On Dec 3, 2021 this sequence version replaced NM_001305103.1.
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data because no single transcript from the same
strain was available for the full length of the gene. The extent of
this transcript is supported by transcript alignments and
orthologous data.
##Evidence-Data-START##
RNAseq introns :: mixed sample support SAMEA103992290,
SAMEA103992323 [ECO:0006172]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-183 JAENSK010000240.1 17128376-17128558 c
184-309 JAENSK010000240.1 17120947-17121072 c
310-370 JAENSK010000240.1 17116210-17116270 c
371-492 JAENSK010000240.1 17107427-17107548 c
493-635 JAENSK010000240.1 17106886-17107028 c
636-820 JAENSK010000240.1 17106495-17106679 c
821-915 JAENSK010000240.1 17102151-17102245 c
916-1103 JAENSK010000240.1 17101082-17101269 c
1104-1175 JAENSK010000240.1 17100302-17100373 c
1176-1269 JAENSK010000240.1 17099932-17100025 c
1270-1395 JAENSK010000240.1 17096839-17096964 c
1396-1549 JAENSK010000240.1 17096311-17096464 c
1550-1724 JAENSK010000240.1 17095958-17096132 c
1725-1813 JAENSK010000240.1 17093994-17094082 c
1814-1936 JAENSK010000240.1 17093560-17093682 c
1937-1963 JAENSK010000240.1 17093023-17093049 c
1964-2107 JAENSK010000240.1 17091833-17091976 c
2108-2274 JAENSK010000240.1 17090722-17090888 c
2275-2440 JAENSK010000240.1 17090178-17090343 c
2441-2525 JAENSK010000240.1 17088549-17088633 c
2526-2675 JAENSK010000240.1 17087751-17087900 c
FEATURES Location/Qualifiers
source 1..2675
/organism="Gallus gallus"
/mol_type="mRNA"
/db_xref="taxon:9031"
/chromosome="9"
/map="9"
gene 1..2675
/gene="USP13"
/note="ubiquitin specific peptidase 13"
/db_xref="CGNC:6766"
/db_xref="GeneID:429286"
exon 1..183
/gene="USP13"
/inference="alignment:Splign:2.1.0"
CDS 31..2619
/gene="USP13"
/EC_number="3.4.19.12"
/note="ubiquitin thioesterase 13; deubiquitinating enzyme
13; ubiquitin-specific-processing protease 13; ubiquitin
specific peptidase 13 (isopeptidase T-3)"
/codon_start=1
/product="ubiquitin carboxyl-terminal hydrolase 13"
/protein_id="NP_001292032.2"
/db_xref="CGNC:6766"
/db_xref="GeneID:429286"
/translation="
MQRAALFGGGDAQMAAGDLGELLVPYMPTIRVPKSGDRVYKTECAFSYDSPDSEGGLYVCMNTFLGFGREHIERHYRKTGQCVYLHLKRHVIEKVPGASGGALPKRRNAKLFLDLEANGDLSSDDFEYEDEAKLVIFPDHYEISLPNIEELPALVTIASDALLSAKSPYRKQDPDSWEEELQASKHAKSLVQLDNGVRIPPSGWKCSKCDLRENLWLNLTDGSVLCGKWFFDGSGGNGHAMEHYKETGYPLAVKLGTITPDGADVYSFDEEEPVLDPHIAKHLAHFGIDMLQMQVAENGLRDNDIKPRVSEWEVIQEAGVKLKPMYGPGYTGMKNLGNSCYLNAVMQAIFSIPEFQRAYVGNLPRIFDYSPLDPTQDFNTQMAKLGHGLLSGQYSKPPMKSELIEQVMKEEHKPQQNGISPQMFKAFISKDHTEFSSNRQQDAQEFFLHLINLVERNPVGSENPSDVFRFLVEERTQCCQSRKVRYTERVDYIMQLPVAMEAATNKDELIAYELKRREAEAARRAPPELVRAKIPFSACLQAFSEPTNVEDFWSSALQAKSAGVKTSRFASFPQYLVVQIKKFTFGLDWIPKKLDVSIDMPDFLDISHLRAMGLQPGEEELPDIAPPIIIPEDPKDRMMNNFVESLDIDESSVMQLAEMGFPLEACRKAVYYTGNLGAEVAFNWIIAHMEEPDFAEPLVVPVFGGAASSGVAGLGAVGLDNQPPEEMVSIIISMGFQRSLAIQALKATNNNLERALEWIFSHPELEEEDGEPALNVMDLENHTNANILAEARSEGPRIKDGPGRYELFGFISHMGTSTMSGHYVCHLKKEGRWVIYNDLRVCASERPPKDLGYIYFYHRIPS"
misc_feature 118..309
/gene="USP13"
/note="Variant UBP zinc finger; Region: zf-UBP_var;
pfam17807"
/db_xref="CDD:407678"
misc_feature 646..864
/gene="USP13"
/note="Zn-finger in ubiquitin-hydrolases and other
protein; Region: zf-UBP; pfam02148"
/db_xref="CDD:460464"
misc_feature 1024..2601
/gene="USP13"
/note="A subfamily of Peptidase C19. Peptidase C19
contains ubiquitinyl hydrolases. They are intracellular
peptidases that remove ubiquitin molecules from
polyubiquinated peptides by cleavage of isopeptide bonds.
They hydrolyze bonds involving the carboxyl...; Region:
Peptidase_C19B; cd02658"
/db_xref="CDD:239123"
misc_feature order(1033..1035,1048..1050,2494..2496,2542..2544)
/gene="USP13"
/note="active site"
/db_xref="CDD:239123"
misc_feature 1969..2115
/gene="USP13"
/note="UBA1 domain found in ubiquitin carboxyl-terminal
hydrolase 13 (UBP13); Region: UBA1_UBP13; cd14384"
/db_xref="CDD:270567"
misc_feature 2197..2322
/gene="USP13"
/note="UBA2 domain found in ubiquitin carboxyl-terminal
hydrolase 5 (UBP5); Region: UBA2_UBP5; cd14386"
/db_xref="CDD:270569"
misc_feature order(2272..2274,2287..2292,2299..2304,2311..2316)
/gene="USP13"
/note="polypeptide substrate binding site [polypeptide
binding]; other site"
/db_xref="CDD:270569"
exon 184..309
/gene="USP13"
/inference="alignment:Splign:2.1.0"
exon 310..370
/gene="USP13"
/inference="alignment:Splign:2.1.0"
exon 371..492
/gene="USP13"
/inference="alignment:Splign:2.1.0"
exon 493..635
/gene="USP13"
/inference="alignment:Splign:2.1.0"
exon 636..820
/gene="USP13"
/inference="alignment:Splign:2.1.0"
exon 821..915
/gene="USP13"
/inference="alignment:Splign:2.1.0"
exon 916..1103
/gene="USP13"
/inference="alignment:Splign:2.1.0"
exon 1104..1175
/gene="USP13"
/inference="alignment:Splign:2.1.0"
exon 1176..1269
/gene="USP13"
/inference="alignment:Splign:2.1.0"
exon 1270..1395
/gene="USP13"
/inference="alignment:Splign:2.1.0"
exon 1396..1549
/gene="USP13"
/inference="alignment:Splign:2.1.0"
exon 1550..1724
/gene="USP13"
/inference="alignment:Splign:2.1.0"
exon 1725..1813
/gene="USP13"
/inference="alignment:Splign:2.1.0"
exon 1814..1936
/gene="USP13"
/inference="alignment:Splign:2.1.0"
exon 1937..1963
/gene="USP13"
/inference="alignment:Splign:2.1.0"
exon 1964..2107
/gene="USP13"
/inference="alignment:Splign:2.1.0"
exon 2108..2274
/gene="USP13"
/inference="alignment:Splign:2.1.0"
exon 2275..2440
/gene="USP13"
/inference="alignment:Splign:2.1.0"
exon 2441..2525
/gene="USP13"
/inference="alignment:Splign:2.1.0"
exon 2526..2675
/gene="USP13"
/inference="alignment:Splign:2.1.0"
ORIGIN
ccgcccgccgtccggaggcaggcaggcggcatgcagcgggccgcgctgttcggcggcggcgacgcgcagatggcggccggggacctgggcgagctgctcgtcccctacatgcccaccatccgcgtgcccaagtccggggaccgggtctacaagacggagtgtgccttctcctacgactctcccgattcagaaggaggtctctatgtgtgcatgaacacgtttctgggatttggaagggaacacattgaaaggcattaccggaaaacaggacagtgtgtatatttgcatctgaaacgacatgtgatagagaaggtaccaggggcatctggtggagctttaccaaaaaggaggaatgctaagctatttttagatctagaggcaaatggtgatctgagcagtgatgattttgaatatgaagatgaagcaaaactcgttatatttcctgatcactatgaaatttcattaccaaacatagaagagttaccagcactggtgacaatagcttctgatgcactcctcagtgcaaaatcaccctacaggaagcaggaccctgactcttgggaagaagagctacaggcatctaagcatgccaaatcgcttgtgcagctagacaacggtgttagaattccccccagtggttggaagtgctcaaaatgtgatcttcgggagaatctgtggctaaacctgacagatggttcagtgttgtgcgggaagtggttctttgatggtagtggagggaatggtcacgcaatggagcactacaaggagacgggttatcccctggcagtgaagttgggaaccatcactcctgatggagcagatgtctattcctttgatgaagaggagccggttttagatccacatatagcaaagcatctggcacactttgggattgatatgctacagatgcaagtggcagagaatggtctaagagataatgatataaaaccaagagtctctgaatgggaagtgattcaggaagctggtgtgaaactcaagcccatgtatggcccaggatataccggcatgaagaacctgggaaatagctgctacctcaacgctgtcatgcaagccattttcagcatcccagagttccagcgagcgtatgtgggaaaccttccgagaatatttgactactccccgcttgatccaacacaagatttcaacactcagatggctaaactgggacatggtctcctttcaggccagtattctaaaccacccatgaaatctgagcttattgaacaggtgatgaaagaagaacacaagcctcaacaaaatggaatatctccccagatgtttaaggcttttataagtaaagaccacacagaattttcctctaatagacaacaagatgcacaggaatttttcctacatcttataaatctagtagagaggaatcctgtaggttcagaaaaccccagtgatgttttccgtttcctggtggaagagcgcacacaatgctgccagtccagaaaagtccgctacactgagagggtagactatatcatgcagttacctgttgccatggaggcggcaacaaacaaagatgaattaattgcatatgagctgaaaaggcgagaagcagaagctgcaaggagagctccaccagaacttgtccgtgccaagatcccatttagtgcatgtttgcaggccttctctgaaccaaccaatgtagaagacttctggagcagtgcccttcaagcaaaatctgcaggagttaagacttctcgttttgcttcatttcctcagtacttagtggtgcagattaagaagttcacctttggccttgactggatacccaaaaagcttgatgtttcgatagacatgccagatttcttagatatcagccaccttcgagccatgggcctccagccaggagaagaggaacttcctgacattgctcctcccattatcattcccgaagacccaaaagatcgtatgatgaacaattttgtggagtctctagatattgatgagtcttcggttatgcaactggcagagatgggttttcctttggaagcatgtcggaaagctgtgtactatacaggcaacctgggtgctgaagtggctttcaactggatcattgcacatatggaagagccagactttgctgagccattggttgtacctgtgtttggaggagctgcttccagtggtgtggctggcttaggggctgttggattggataatcaacctcctgaagagatggtctccatcatcatttccatgggcttccaaaggagcttagcaattcaagctctgaaggcaacaaacaataacttggagcgtgcactggaatggatcttcagccaccctgaattagaggaggaagatggggagcctgctttgaacgtgatggatttggagaaccatacaaatgcgaatatccttgcagaggcaagatcagagggacccaggatcaaagatgggcctggaaggtacgagctgtttgggttcatcagccacatgggaacatccacaatgagtggtcactatgtttgtcatctcaaaaaagaaggaagatgggtgatctacaatgaccttagagtctgtgcctcagaacgacctcccaaagatctgggctacatctatttttaccacaggataccaagttagacctcaaatgtattatctggccttaagaagccgtaagcctttttaacctgccaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]