2025-09-16 21:54:31, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS NM_001198662 3250 bp mRNA linear VRT 29-JUL-2024 DEFINITION Gallus gallus ectonucleotide pyrophosphatase/phosphodiesterase 2 (ENPP2), mRNA. ACCESSION NM_001198662 XM_418466 VERSION NM_001198662.2 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 3250) AUTHORS Tang,H., Finn,R.D. and Thomas,P.D. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 REFERENCE 2 (bases 1 to 3250) AUTHORS Burge,S., Kelly,E., Lonsdale,D., Mutowo-Muellenet,P., McAnulla,C., Mitchell,A., Sangrador-Vegas,A., Yong,S.Y., Mulder,N. and Hunter,S. TITLE Manual GO annotation of predictive protein signatures: the InterPro approach to GO curation JOURNAL Database (Oxford) 2012, bar068 (2012) PUBMED 22301074 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 3250) AUTHORS Ohuchi,H., Fukui,H., Matsuyo,A., Tomonari,S., Tanaka,M., Arai,H., Noji,S. and Aoki,J. TITLE Autotaxin controls caudal diencephalon-mesencephalon development in the chick JOURNAL Dev Dyn 239 (10), 2647-2658 (2010) PUBMED 20737506 REMARK GeneRIF: ATX RNA interference altered the expression pattern of Pax6-regualted genes, Tcf4, Lim1, and En1, implying that ATX is required for the maintenance of the regional identity of the caudal diencephalon and the diencephalon-mesencephalon boundary (DMB). REFERENCE 4 (bases 1 to 3250) AUTHORS Ahanda,M.L., Ruby,T., Wittzell,H., Bed'Hom,B., Chausse,A.M., Morin,V., Oudin,A., Chevalier,C., Young,J.R. and Zoorob,R. TITLE Non-coding RNAs revealed during identification of genes involved in chicken immune responses JOURNAL Immunogenetics 61 (1), 55-70 (2009) PUBMED 19009289 REFERENCE 5 (bases 1 to 3250) AUTHORS Ohuchi,H., Hayashibara,Y., Matsuda,H., Onoi,M., Mitsumori,M., Tanaka,M., Aoki,J., Arai,H. and Noji,S. TITLE Diversified expression patterns of autotaxin, a gene for phospholipid-generating enzyme during mouse and chicken development JOURNAL Dev Dyn 236 (4), 1134-1143 (2007) PUBMED 17366625 REMARK GeneRIF: Non-conserved roles for ATX during neural development and organogenesis. Erratum:[Dev Dyn. 2007 May;236(5):1376. Hayashibaral, Yasunori [corrected to Hayashibara, Yasunori]] REFERENCE 6 (bases 1 to 3250) AUTHORS Boardman,P.E., Sanz-Ezquerro,J., Overton,I.M., Burt,D.W., Bosch,E., Fong,W.T., Tickle,C., Brown,W.R., Wilson,S.A. and Hubbard,S.J. TITLE A comprehensive collection of chicken cDNAs JOURNAL Curr Biol 12 (22), 1965-1969 (2002) PUBMED 12445392 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JAENSK010000044.1. On Sep 23, 2021 this sequence version replaced NM_001198662.1. Sequence Note: This RefSeq record was created from transcript sequence data from multiple strains. The extent of this transcript is supported by transcript alignments and orthologous data. ##Evidence-Data-START## Transcript exon combination :: AB285185.1, SRR13267658.5612.1 [ECO:0000332] RNAseq introns :: mixed sample support SAMEA103992290, SAMEA103992323 [ECO:0006172] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-262 JAENSK010000044.1 15401163-15401424 c 263-365 JAENSK010000044.1 15400763-15400865 c 366-521 JAENSK010000044.1 15395680-15395835 c 522-647 JAENSK010000044.1 15393474-15393599 c 648-708 JAENSK010000044.1 15391419-15391479 c 709-806 JAENSK010000044.1 15390051-15390148 c 807-886 JAENSK010000044.1 15388985-15389064 c 887-1006 JAENSK010000044.1 15387693-15387812 c 1007-1062 JAENSK010000044.1 15378410-15378465 c 1063-1128 JAENSK010000044.1 15376174-15376239 c 1129-1201 JAENSK010000044.1 15375424-15375496 c 1202-1313 JAENSK010000044.1 15366990-15367101 c 1314-1439 JAENSK010000044.1 15365462-15365587 c 1440-1471 JAENSK010000044.1 15363297-15363328 c 1472-1599 JAENSK010000044.1 15362395-15362522 c 1600-1687 JAENSK010000044.1 15360780-15360867 c 1688-1775 JAENSK010000044.1 15360522-15360609 c 1776-1948 JAENSK010000044.1 15359513-15359685 c 1949-1997 JAENSK010000044.1 15359186-15359234 c 1998-2134 JAENSK010000044.1 15356742-15356878 c 2135-2270 JAENSK010000044.1 15356187-15356322 c 2271-2348 JAENSK010000044.1 15354993-15355070 c 2349-2481 JAENSK010000044.1 15352493-15352625 c 2482-2638 JAENSK010000044.1 15351721-15351877 c 2639-3250 JAENSK010000044.1 15345932-15346543 c FEATURES Location/Qualifiers source 1..3250 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="2" /map="2" gene 1..3250 /gene="ENPP2" /note="ectonucleotide pyrophosphatase/phosphodiesterase 2" /db_xref="CGNC:12299" /db_xref="GeneID:420361" exon 1..262 /gene="ENPP2" /inference="alignment:Splign:2.1.0" misc_feature 182..184 /gene="ENPP2" /note="upstream in-frame stop codon" CDS 230..2809 /gene="ENPP2" /EC_number="3.1.4.39" /note="ectonucleotide pyrophosphatase/phosphodiesterase family member 2" /codon_start=1 /product="autotaxin" /protein_id="NP_001185591.1" /db_xref="CGNC:12299" /db_xref="GeneID:420361" /translation="
MAKKGCFYFHQVISLFAFAFGVNVCMGFTTNRFRRSEEWDEGPISVLSDSPWISTSGSCKNRCFELQEAEPPGCRCDNLCKSYNSCCFDFDELCLKTARGWECTKDRCGETRNDDNACHCSEDCLSRGDCCTNYQVVCKGETHWVDDDCEEIKTPECPAGFVRPPLIIFSVDGFRASYMKKGNKVMPNIEKLRSCGTHSPYMRPVYPTKTFPNLYTLATGLYPESHGIVGNSMYDPVFDASFSLRGREKFNHRWWGGQPIWITAAKQGVKAGTFFWSVVIPHERRILTILQWLTLPDNERPYVYAFYSEQPDAAGHRYGPFNSEMMVNPLREIDKTVGQLMDGLKQLKLHRCVNVIFVGDHGMEDTTCERTEFLSNYLTNVEDIILLPGSLGRIRPRSSNNLKYDPKVIVANLTCRKPDQHFKPYLKHHLPKRLHYAYNRRIEDVHLLVERKWHVARKAVDVYKKPTGKCFFHGDHGYDNKINSMQTVFIGYGPTFKYKTKVPPFENIELYNVMCDLLGLKPAPNNGTHGSLNHLLRANVYKPTVPDEVAKPLYPVALPSASDFDIGCTCDDKNKLDELNKRFHVKGTEEKHLLYGRPAVLYRTKYNILHHHDFESGYSETFLMPLWTSYTISKQAEVSGVPEHLASCVRPDLRISPGNSQSCSAYRGDKQLSYSFLFPPQLSSSAEAKYDAFLITNIIPMYPAFKKVWNYFQRVLVKRYATERNGVNVISGPIFDYDYDGLHDTPEKIKQFVEGSAIPVPTHYYAIITSCLDFTQPADKCDGPLSVLSYILPHRPDNDESCNSMEDESKWVEDLLKMHTARVRDIEQLTSLDFFRKTSRSYTEILSLKTYLHTFESEI"
misc_feature 398..523 /gene="ENPP2" /note="Somatomedin B -like domains; Region: SO; smart00201" /db_xref="CDD:197571" misc_feature 524..655 /gene="ENPP2" /note="Somatomedin B -like domains; Region: SO; smart00201" /db_xref="CDD:197571" misc_feature 725..1666 /gene="ENPP2" /note="Type I phosphodiesterase / nucleotide pyrophosphatase; Region: Phosphodiest; pfam01663" /db_xref="CDD:396300" misc_feature order(743..745,854..859,920..922,1163..1165,1175..1177, 1307..1312,1655..1657) /gene="ENPP2" /note="active site" /db_xref="CDD:293742" misc_feature order(743..745,854..859,920..922,1163..1165,1175..1177, 1310..1312,1655..1657) /gene="ENPP2" /note="substrate binding site [chemical binding]; other site" /db_xref="CDD:293742" misc_feature 1730..1738 /gene="ENPP2" /note="homodimer interface [polypeptide binding]; other site" /db_xref="CDD:293742" misc_feature 2060..2752 /gene="ENPP2" /note="DNA/RNA non-specific endonuclease; Region: NUC; smart00477" /db_xref="CDD:214683" misc_feature order(2246..2251,2255..2257,2366..2368,2378..2380) /gene="ENPP2" /note="active site" /db_xref="CDD:238043" misc_feature order(2246..2251,2378..2380) /gene="ENPP2" /note="substrate binding site [chemical binding]; other site" /db_xref="CDD:238043" exon 263..365 /gene="ENPP2" /inference="alignment:Splign:2.1.0" exon 366..521 /gene="ENPP2" /inference="alignment:Splign:2.1.0" exon 522..647 /gene="ENPP2" /inference="alignment:Splign:2.1.0" exon 648..708 /gene="ENPP2" /inference="alignment:Splign:2.1.0" exon 709..806 /gene="ENPP2" /inference="alignment:Splign:2.1.0" exon 807..886 /gene="ENPP2" /inference="alignment:Splign:2.1.0" exon 887..1006 /gene="ENPP2" /inference="alignment:Splign:2.1.0" exon 1007..1062 /gene="ENPP2" /inference="alignment:Splign:2.1.0" exon 1063..1128 /gene="ENPP2" /inference="alignment:Splign:2.1.0" exon 1129..1201 /gene="ENPP2" /inference="alignment:Splign:2.1.0" exon 1202..1313 /gene="ENPP2" /inference="alignment:Splign:2.1.0" exon 1314..1439 /gene="ENPP2" /inference="alignment:Splign:2.1.0" exon 1440..1471 /gene="ENPP2" /inference="alignment:Splign:2.1.0" exon 1472..1599 /gene="ENPP2" /inference="alignment:Splign:2.1.0" exon 1600..1687 /gene="ENPP2" /inference="alignment:Splign:2.1.0" exon 1688..1775 /gene="ENPP2" /inference="alignment:Splign:2.1.0" exon 1776..1948 /gene="ENPP2" /inference="alignment:Splign:2.1.0" exon 1949..1997 /gene="ENPP2" /inference="alignment:Splign:2.1.0" exon 1998..2134 /gene="ENPP2" /inference="alignment:Splign:2.1.0" exon 2135..2270 /gene="ENPP2" /inference="alignment:Splign:2.1.0" exon 2271..2348 /gene="ENPP2" /inference="alignment:Splign:2.1.0" exon 2349..2481 /gene="ENPP2" /inference="alignment:Splign:2.1.0" exon 2482..2638 /gene="ENPP2" /inference="alignment:Splign:2.1.0" exon 2639..3250 /gene="ENPP2" /inference="alignment:Splign:2.1.0" ORIGIN
gggggagggcgcagcgagggatgatgcctggagcttcttgcactcggagctgcgatttgtgagtgaaacatgatgaaatcaccccctggacaaatcacacgagcctgtcaacctcaccaggtgggattacttgtagctaatagcccgaactcccagagcaaacagagctctgcgctcactataaagcaaaagggacggtaccgcacgggcttttcaagaatcctctagtatggctaagaagggctgcttctacttccaccaggtcatatctttatttgcttttgcctttggagtaaatgtctgcatgggatttacaacaaatcgctttaggagatctgaagaatgggatgagggcccaatctcagtcctgtcagattccccctggatcagtacctctggctcctgcaaaaacagatgctttgaacttcaagaggcagagcctcctggctgccgctgtgacaacctgtgcaagagctacaacagctgctgcttcgactttgatgagctgtgcttaaagacagctcgaggctgggaatgtaccaaagaccgctgtggagaaaccaggaatgatgacaatgcttgtcactgctctgaagactgcttaagtagaggagactgttgcactaattaccaggtcgtttgcaaaggagaaacccactgggtcgatgatgactgtgaagagataaaaactcctgaatgtccagcaggctttgttcgtcctcctttgatcatcttctctgttgatggtttccgtgcatcatatatgaagaaagggaacaaggtcatgcccaatattgaaaagctgagatcttgtggaacacattctccttacatgaggccggtctatcctacaaaaaccttccccaacttgtacacccttgctactggactctatcctgaatcacatggaatcgttggcaattcaatgtatgacccagtgtttgatgccagcttcagtcttcgagggcgagagaaattcaatcacagatggtggggaggtcaaccaatttggattactgcagccaagcaaggggtgaaagctggcacattcttctggtctgttgtcatcccccacgagcgtagaatactaacaatactgcagtggctgacccttccggataacgaaaggccttatgtttatgctttctactctgagcaaccagatgctgctggccacagatatggtcctttcaactcagagatgatggtaaatcccctgagagagattgacaagacagtaggacaactaatggatggactgaaacagctgaaactgcatcgatgtgtcaatgtcatatttgttggtgatcatgggatggaagacactacttgtgaaagaactgaatttttgagcaactacctgaccaacgtggaagatatcattctgctgcctggatctttagggagaattcgccctaggtctagcaataacctgaaatatgaccccaaagtgattgttgccaaccttacatgcaggaagccagaccagcactttaagccatacttgaagcatcaccttcctaaacgcttgcactatgcttacaataggcgaattgaggatgtccatttactggtcgagcgcaagtggcatgtagcaaggaaagctgtggatgtttacaagaaaccaacaggaaagtgtttcttccatggagaccatggctatgacaacaagataaacagcatgcagactgtcttcataggttatggacctacattcaaatacaagaccaaagtaccgccttttgaaaacattgaactttacaatgtcatgtgtgatctgcttggattaaagcctgctcccaataatggtacccacggaagtttgaatcacctgctaagagccaatgtttataaaccaactgtgccagatgaagttgctaagccactttatcctgtagctctaccttctgcatcagattttgatataggatgtacatgtgatgataagaacaagttggatgaactcaacaagcgctttcatgtcaagggaacggaagagaagcatcttctgtacgggcgccctgcagtgctgtaccgcacgaagtacaatatcttgcaccaccatgactttgaaagtggctacagtgaaacattcctgatgcctctctggacatcctacactatttccaaacaggcagaggtatccggtgtcccagaacacctggccagctgcgtcaggcccgatctccgcatatctccaggaaacagccagagctgctcagcctacagaggtgacaagcagctctcctacagcttcctcttccctcctcaactaagttcctctgcagaagcaaagtatgatgcttttctaataacaaatatcattccaatgtatcctgctttcaaaaaggtatggaactatttccaaagggttttagtgaagagatatgccactgaacgaaatggagtcaatgttataagtggaccaatctttgactatgactatgatggtttacatgacacacctgaaaaaatcaaacagtttgtggaaggcagtgccatccctgttcctactcattactatgccatcataaccagctgtttagatttcactcagccagccgacaagtgtgatggaccactctctgttctctcgtacatccttccccaccggcctgacaacgatgagagctgcaatagcatggaagatgaatcaaagtgggttgaagatcttcttaagatgcacactgcacgggtgcgggacattgagcagctcacaagcttggacttcttccgaaagacgagtcgcagctacacagaaatcctctccctaaagacatacctgcatacatttgaaagtgaaatttagctttctaaccttgctcagtgcattcttttatcaactggtgtatatttttatattgtttttatatttattaatttgaaaccaggacattaaaaatattagtattttaatcttgtatcaaatcttaaatattaaacccttgtgtcatttgttttgtttctctaatgtttaatataggtatgtctcttggtttatttagtagcgcttgtaatactgcagcttaagtccttactccaagcttttatctggtgctgcagaatttgatacgtgattcgaggaaatattaatttcccatgctcctttaccacacttttagtcctgtactgtgtatcaaaatactgaacatgtaaaattacattcatttactgttgactatgtgacagacatatttaaaccctatagacaaatagcatcttaaatataataaaccacacattcagtttt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]