GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-09-16 19:54:22, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       NM_001005427            2247 bp    mRNA    linear   VRT 23-SEP-2023
DEFINITION  Gallus gallus mesenchyme homeobox 2 (MEOX2), mRNA.
ACCESSION   NM_001005427 XM_418692
VERSION     NM_001005427.2
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 2247)
  AUTHORS   Tang H, Finn RD and Thomas PD.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   2  (bases 1 to 2247)
  AUTHORS   Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C,
            Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S.
  TITLE     Manual GO annotation of predictive protein signatures: the InterPro
            approach to GO curation
  JOURNAL   Database (Oxford) 2012, bar068 (2012)
   PUBMED   22301074
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 2247)
  AUTHORS   Reijntjes S, Stricker S and Mankoo BS.
  TITLE     A comparative analysis of Meox1 and Meox2 in the developing somites
            and limbs of the chick embryo
  JOURNAL   Int J Dev Biol 51 (8), 753-759 (2007)
   PUBMED   17939123
  REMARK    GeneRIF: In the limb bud, Meox1 is co-expressed with Meox2 but
            neither Meox gene is co-expressed with MyoD, suggesting that these
            two genes have overlapping and distinct functions in development
REFERENCE   4  (bases 1 to 2247)
  AUTHORS   Rallis C, Stamataki D, Pontikakis S, Mankoo BS and Karagogeos D.
  TITLE     Isolation of the avian homologue of the homeobox gene Mox2 and
            analysis of its expression pattern in developing somites and limbs
  JOURNAL   Mech Dev 104 (1-2), 121-124 (2001)
   PUBMED   11404088
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from
            JAENSK010000036.1.
            
            On Sep 23, 2021 this sequence version replaced NM_001005427.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR13267653.992.1, AJ401088.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA103992415 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-800               JAENSK010000036.1  20142710-20143509   c
            801-973             JAENSK010000036.1  20104281-20104453   c
            974-2247            JAENSK010000036.1  20090404-20091677   c
FEATURES             Location/Qualifiers
     source          1..2247
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="2"
                     /map="2"
     gene            1..2247
                     /gene="MEOX2"
                     /note="mesenchyme homeobox 2"
                     /db_xref="CGNC:8206"
                     /db_xref="GeneID:374137"
     exon            1..800
                     /gene="MEOX2"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    275..277
                     /gene="MEOX2"
                     /note="upstream in-frame stop codon"
     CDS             290..1198
                     /gene="MEOX2"
                     /note="mesenchyme homeo box 2 (growth arrest-specific
                     homeo box)"
                     /codon_start=1
                     /product="homeobox protein MOX-2"
                     /protein_id="NP_001005427.2"
                     /db_xref="CGNC:8206"
                     /db_xref="GeneID:374137"
                     /translation="
MDHTLFGCLRSPHATAQSLHPFSQSSLALHGRSDHMSYPDLSSSSSSCIITGYPNEEGMFASQHHRGHHHHHHHHHHHHQQQQHQALQTNWHIPQMSSPPAAARHSLCLQPDSGGPPELGSSPPVLCSNSSSLGTTTPTGAACAPGDYGRQALSPVETEKRSGKRKSDSSDSQEGNYKSEVNSKPRKERTAFTKEQIRELEAEFAHHNYLTRLRRYEIAVNLDLTERQVKVWFQNRRMKWKRVKGGQQGAAAREKELVNVKKGTLLPSELSGIGAAGLQHTGDSLANDDSHDSDHSSEHAHL"
     misc_feature    758..1102
                     /gene="MEOX2"
                     /note="Homeodomain-containing transcription factor
                     [Transcription]; Region: COG5576"
                     /db_xref="CDD:227863"
     misc_feature    845..1015
                     /gene="MEOX2"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     exon            801..973
                     /gene="MEOX2"
                     /inference="alignment:Splign:2.1.0"
     exon            974..2247
                     /gene="MEOX2"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
aagcagttctctgggaccaccttctattggcttcaacctctcccacttcttgacatctgagcagctctgagaaaggctcatctaggtccgagtgtttatgcagcggagactggccgctagggctaaagacctggattatctgagctcagttgcctgctgcaaagtctgtcgttgccgttttggaaaaaaaaaatctcagccccgatctgtttacagtgaaagttgacaaagggtggtgaagttggatccttcctaaactctcctgcctggaacctgagacttgcatgccatggatcacacactctttggctgcctgcgcagcccccatgccaccgcgcagagcttgcatcctttctcccagtcttctcttgccctgcatggaagatccgaccacatgtcctaccccgatctgtcttcttcttcttcctcttgcataataacgggataccccaatgaggagggcatgtttgccagccagcatcatagggggcaccaccaccaccaccatcaccaccaccatcaccaccagcaacagcagcaccaggctttgcagacgaactggcacatccctcagatgtcgtctcctcccgccgcggccaggcacagcctctgtctccagccggactcaggaggacccccggagctgggcagcagcccccccgtgctgtgttcgaactcctccagcctgggcactaccacccccacgggggcagcgtgtgcgccgggggactatggcaggcaggctctgtccccggtggaaacggagaagaggtccggcaagaggaaaagcgacagctcagattcccaagaaggaaactacaagtcagaggtcaacagtaaacccaggaaggaaaggacagctttcaccaaggagcaaatcagagagctagaagcagaatttgctcatcataactatttgaccaggctgaggagatatgagatagcagtaaaccttgacctcactgaaagacaggtaaaagtttggttccagaacagacggatgaagtggaagcgggtaaaaggaggccagcaaggggcagcagcccgggaaaaggaactggtgaatgtgaaaaaaggcacgctgctcccctccgagctctctggcattggggcagctggtctccagcacacgggggactcactagcgaatgatgacagccacgacagcgatcacagctctgagcacgcacacttatgatacacagagagtgtcccagctccgttctcaggaaagatgctttgctggcaagccttacacaggcatcgtttacgtatgcaagtgactggcagtgatttttaaagttgttatggaagattcaggcttattgtgtctgtttttcttgatttttagatggtttacagtaagtgccatgtcttaaaggtgcctcaagagtggagaagtggaagatgaactttgaacattccagatttgtttgtcatgtttatgacagcgggcaggtattttgctttagcttgcactgaaaattacattgctctcaacagacgttatattctgaaaaccacagtgccacaaaatcactatctagtggataagaaatgtattttaactctgtatatatttaccttacagcattttcctgtcttcactaattttagcaatgcattcatattagctgatggcaatagtcactcatgacaataaatggctttttgtctctttaatttttgttttgtttcgccaaagacatacaatacatgcagatacttttgttcaagtagagaacgtatctgctaggacacgtccttgtatgacagacaaaacaaacattatgttgcatttactatcaactgctgctaatagggtattattaaacttacctagctcctcaattcttcttatcttataactgcaaaaaaatgatttttaggatcataaggatagtccagtaacctgccacaaaattttcatgctcagtggaaaccccagaaaggattattcatttctactttgtcatcactgagtacattaatactgactctgcggaaatgtctcttcatcttcagtttaaaaaacagcagtcagctgagttattatcaactgcttatgttggtaggaatcaaaatatgaaggtaactcagtattgtgtcccgtgtgtaaaatcaagacatattttctgttataagcttttgtgtacatacaggcaaacaccaaaactcaaaatttaatacaaaccattgattgtactttgtaaagaaaaatgtttaataaataatcatttttaaata
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]