2024-05-14 18:45:21, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_214258 1236 bp mRNA linear MAM 22-DEC-2022 DEFINITION Sus scrofa protein kinase cAMP-dependent type II regulatory subunit alpha (PRKAR2A), mRNA. ACCESSION NM_214258 VERSION NM_214258.2 KEYWORDS RefSeq. SOURCE Sus scrofa (pig) ORGANISM Sus scrofa Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Suina; Suidae; Sus. REFERENCE 1 (bases 1 to 1236) AUTHORS Nishimura T, Fujii W, Sugiura K and Naito K. TITLE Cytoplasmic anchoring of cAMP-dependent protein kinase (PKA) by A-kinase anchor proteins (AKAPs) is required for meiotic arrest of porcine full-grown and growing oocytes JOURNAL Biol Reprod 90 (3), 58 (2014) PUBMED 24501172 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 1236) AUTHORS Nishimura T, Sugiura K and Naito K. TITLE A-kinase anchor protein 1 (AKAP1) regulates cAMP-dependent protein kinase (PKA) localization and is involved in meiotic maturation of porcine oocytes JOURNAL Biol Reprod 88 (4), 85 (2013) PUBMED 23426434 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 1236) AUTHORS Nishimura T, Fujii W, Kano K, Sugiura K and Naito K. TITLE Analyses of the involvement of PKA regulation mechanism in meiotic incompetence of porcine growing oocytes JOURNAL Biol Reprod 87 (3), 53 (2012) PUBMED 22674394 REMARK GeneRIF: Analyses of the involvement of PKA regulation mechanism in meiotic incompetence of porcine growing oocytes. Publication Status: Online-Only REFERENCE 4 (bases 1 to 1236) AUTHORS Hemmings,B.A., Schwarz,M., Adavani,S.R. and Jans,D.A. TITLE Expression cloning of a cDNA encoding the type II regulatory subunit of the cAMP-dependent protein kinase JOURNAL FEBS Lett 209 (2), 219-222 (1986) PUBMED 2431926 REFERENCE 5 (bases 1 to 1236) AUTHORS Potter,R.L. and Taylor,S.S. TITLE Correlation of the cAMP binding domain with a site of autophosphorylation on the regulatory subunit of cAMP-dependent protein kinase II from porcine skeletal muscle JOURNAL J Biol Chem 254 (18), 9000-9005 (1979) PUBMED 225318 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AB499528.1. On Jun 11, 2010 this sequence version replaced NM_214258.1. ##Evidence-Data-START## Transcript exon combination :: AB499528.1, SRR5275321.436620.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA103886111, SAMEA103886112 [ECO:0000350] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..1236 /organism="Sus scrofa" /mol_type="mRNA" /db_xref="taxon:9823" /chromosome="13" /map="13" gene 1..1236 /gene="PRKAR2A" /note="protein kinase cAMP-dependent type II regulatory subunit alpha" /db_xref="GeneID:397493" /db_xref="VGNC:VGNC:91804" exon 1..254 /gene="PRKAR2A" /inference="alignment:Splign:2.1.0" CDS 2..1207 /gene="PRKAR2A" /EC_number="2.7.11.1" /note="cAMP-dependent protein kinase, regulatory subunit alpha 2" /codon_start=1 /product="cAMP-dependent protein kinase type II-alpha regulatory subunit" /protein_id="NP_999423.2" /db_xref="GeneID:397493" /db_xref="VGNC:VGNC:91804" /translation="
MSHIQIPPGLTELLQGYTVEVLRRQPPDLVDFAVDYFTRLREARSRASTPPAAPPSGSQDLEPSSGLVTDAIADSESEDDEDLDVPIPSRFDRRVSVCAETYNPDEEEEDTDPRVIHPKTDQQRCRLQEACKDILLFKNLDQEQLSQVLDAMFERTVKVDEHVIDQGDDGDNFYVIERGTYDILVTKDNQTRSVGQYDNHGSFGELALMYNTPRAATIVATSEGSLWGLDRVTFRRIIVKNNAKKRKMFESFIESVPLLKSLEVSERMKIVDVIGEKIYKDGERIITQGEKADSFYIIESGEVSILIKSKTKANKDGGNQEVEIARCHKGQYFGELALVTNKPRAASAYAVGDVKCLVMDVQAFERLLGPCMDIMKRNISHYEEQLVKMFGSSMDLIDPGQ"
misc_feature 11..133 /gene="PRKAR2A" /note="dimerization/docking (D/D) domain of the Type II alpha Regulatory subunit of cAMP-dependent protein kinase; Region: DD_RIIalpha_PKA; cd12103" /db_xref="CDD:438524" misc_feature order(11..25,29..31,38..43,50..55,62..67,74..76,83..94, 98..103,110..115,119..124) /gene="PRKAR2A" /note="dimer interface [polypeptide binding]; other site" /db_xref="CDD:438524" misc_feature order(17..19,29..34,41..46,53..58,65..70) /gene="PRKAR2A" /note="AKAP interaction site [polypeptide binding]; other site" /db_xref="CDD:438524" misc_feature 407..745 /gene="PRKAR2A" /note="effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038" /db_xref="CDD:237999" misc_feature order(611..616,641..649) /gene="PRKAR2A" /note="ligand binding site [chemical binding]; other site" /db_xref="CDD:237999" misc_feature order(707..715,725..733) /gene="PRKAR2A" /note="flexible hinge region; other site" /db_xref="CDD:237999" misc_feature 773..1138 /gene="PRKAR2A" /note="effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038" /db_xref="CDD:237999" misc_feature order(1001..1006,1031..1039) /gene="PRKAR2A" /note="ligand binding site [chemical binding]; other site" /db_xref="CDD:237999" misc_feature order(1097..1105,1115..1123) /gene="PRKAR2A" /note="flexible hinge region; other site" /db_xref="CDD:237999" exon 255..290 /gene="PRKAR2A" /inference="alignment:Splign:2.1.0" exon 291..343 /gene="PRKAR2A" /inference="alignment:Splign:2.1.0" exon 344..427 /gene="PRKAR2A" /inference="alignment:Splign:2.1.0" exon 428..534 /gene="PRKAR2A" /inference="alignment:Splign:2.1.0" exon 535..688 /gene="PRKAR2A" /inference="alignment:Splign:2.1.0" exon 689..790 /gene="PRKAR2A" /inference="alignment:Splign:2.1.0" exon 791..865 /gene="PRKAR2A" /inference="alignment:Splign:2.1.0" exon 866..931 /gene="PRKAR2A" /inference="alignment:Splign:2.1.0" exon 932..1073 /gene="PRKAR2A" /inference="alignment:Splign:2.1.0" exon 1074..1236 /gene="PRKAR2A" /inference="alignment:Splign:2.1.0" ORIGIN
catgagccacatccagatcccgcctgggctcacggagctgctgcagggctacaccgtggaggtgctgcggcggcagccacccgacctggtcgacttcgcggtggactacttcacccgcctgcgcgaggcccgctcccgagcctccaccccacccgccgcccctccttccggctcccaggatctagagcccagctctggccttgtcaccgacgcgatcgcggacagcgagtcggaggacgacgaggacttggacgttccaattcctagcagatttgatcggcgagtatcagtctgtgctgagacctataaccctgatgaggaagaggaagatactgatccaagggtgattcaccctaaaactgatcaacaaagatgcagacttcaagaagcttgcaaagatattcttcttttcaaaaatcttgatcaggaacaactttctcaagtcctcgatgctatgtttgaaaggacagtcaaagttgatgagcatgtcattgaccaaggagatgatggagacaacttttatgttattgaacggggaacctatgatattttagtaacaaaagataatcaaacccgctctgttggtcagtatgacaaccatggcagttttggagaactagctctgatgtacaacaccccgagagctgctaccattgtcgccacttcagaaggctccctttggggactggaccgtgtgacttttagaagaatcatagtgaaaaacaatgcaaaaaagaggaagatgtttgaatcatttattgaatctgtgccactccttaaatcactagaggtgtcagaacgaatgaagatcgtggatgtaataggagaaaagatctataaggatggagagcgcatcatcacacagggtgaaaaggctgatagcttttacattatagagtctggtgaagtgagcatcttgattaaaagcaagactaaagcaaacaaggatggtgggaaccaggaggtcgagattgcccgctgccacaaggggcagtactttggagagcttgcactggtcaccaacaaacccagagctgcttcagcttatgcagtgggagatgtcaaatgcttagttatggatgtacaagcatttgagaggcttctggggccctgcatggacatcatgaagaggaacatctcacactatgaggaacagctggtgaagatgtttggctccagcatggatctgatcgatcccgggcagtaggtgtgccacaccccagagccttctcagtg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]