GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-15 05:15:23, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_123966               1151 bp    mRNA    linear   PLN 20-OCT-2022
DEFINITION  Arabidopsis thaliana WUSCHEL related homeobox 8 (WOX8), mRNA.
ACCESSION   NM_123966
VERSION     NM_123966.3
DBLINK      BioProject: PRJNA116
            BioSample: SAMN03081427
KEYWORDS    RefSeq.
SOURCE      Arabidopsis thaliana (thale cress)
  ORGANISM  Arabidopsis thaliana
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Camelineae; Arabidopsis.
REFERENCE   1  (bases 1 to 1151)
  AUTHORS   Tabata,S., Kaneko,T., Nakamura,Y., Kotani,H., Kato,T., Asamizu,E.,
            Miyajima,N., Sasamoto,S., Kimura,T., Hosouchi,T., Kawashima,K.,
            Kohara,M., Matsumoto,M., Matsuno,A., Muraki,A., Nakayama,S.,
            Nakazaki,N., Naruo,K., Okumura,S., Shinpo,S., Takeuchi,C., Wada,T.,
            Watanabe,A., Yamada,M., Yasuda,M., Sato,S., de la Bastide,M.,
            Huang,E., Spiegel,L., Gnoj,L., O'Shaughnessy,A., Preston,R.,
            Habermann,K., Murray,J., Johnson,D., Rohlfing,T., Nelson,J.,
            Stoneking,T., Pepin,K., Spieth,J., Sekhon,M., Armstrong,J.,
            Becker,M., Belter,E., Cordum,H., Cordes,M., Courtney,L.,
            Courtney,W., Dante,M., Du,H., Edwards,J., Fryman,J., Haakensen,B.,
            Lamar,E., Latreille,P., Leonard,S., Meyer,R., Mulvaney,E.,
            Ozersky,P., Riley,A., Strowmatt,C., Wagner-McPherson,C., Wollam,A.,
            Yoakum,M., Bell,M., Dedhia,N., Parnell,L., Shah,R., Rodriguez,M.,
            See,L.H., Vil,D., Baker,J., Kirchoff,K., Toth,K., King,L.,
            Bahret,A., Miller,B., Marra,M., Martienssen,R., McCombie,W.R.,
            Wilson,R.K., Murphy,G., Bancroft,I., Volckaert,G., Wambutt,R.,
            Dusterhoft,A., Stiekema,W., Pohl,T., Entian,K.D., Terryn,N.,
            Hartley,N., Bent,E., Johnson,S., Langham,S.A., McCullagh,B.,
            Robben,J., Grymonprez,B., Zimmermann,W., Ramsperger,U., Wedler,H.,
            Balke,K., Wedler,E., Peters,S., van Staveren,M., Dirkse,W.,
            Mooijman,P., Lankhorst,R.K., Weitzenegger,T., Bothe,G., Rose,M.,
            Hauf,J., Berneiser,S., Hempel,S., Feldpausch,M., Lamberth,S.,
            Villarroel,R., Gielen,J., Ardiles,W., Bents,O., Lemcke,K.,
            Kolesov,G., Mayer,K., Rudd,S., Schoof,H., Schueller,C.,
            Zaccaria,P., Mewes,H.W., Bevan,M. and Fransz,P.
  CONSRTM   Kazusa DNA Research Institute; Cold Spring Harbor and Washington
            University in St Louis Sequencing Consortium; European Union
            Arabidopsis Genome Sequencing Consortium
  TITLE     Sequence and analysis of chromosome 5 of the plant Arabidopsis
            thaliana
  JOURNAL   Nature 408 (6814), 823-826 (2000)
   PUBMED   11130714
REFERENCE   2  (bases 1 to 1151)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (19-OCT-2022) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 1151)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   4  (bases 1 to 1151)
  AUTHORS   Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E.
  CONSRTM   TAIR
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2011) Department of Plant Biology, Carnegie
            Institution, 260 Panama Street, Stanford, CA, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by TAIR and Araport.
            This record is derived from an annotated genomic sequence
            (NC_003076).
            
            On Sep 12, 2016 this sequence version replaced NM_123966.2.
FEATURES             Location/Qualifiers
     source          1..1151
                     /organism="Arabidopsis thaliana"
                     /mol_type="mRNA"
                     /db_xref="taxon:3702"
                     /chromosome="5"
                     /ecotype="Columbia"
     gene            1..1151
                     /gene="WOX8"
                     /locus_tag="AT5G45980"
                     /gene_synonym="MCL19.2; MCL19_2; STIMPY-LIKE; STPL; WOX9B;
                     WUSCHEL related homeobox 8; WUSCHEL related homeobox 9B"
                     /note="Arabidopsis thaliana WOX8 protein. Contains
                     similarity to homeodomain transcription factor. Positively
                     regulates early embryonic growth. Together with CLE8 it
                     forms a signaling module that promotes seed growth and
                     overall seed size."
                     /db_xref="Araport:AT5G45980"
                     /db_xref="GeneID:834638"
                     /db_xref="TAIR:AT5G45980"
     CDS             36..1013
                     /gene="WOX8"
                     /locus_tag="AT5G45980"
                     /gene_synonym="MCL19.2; MCL19_2; STIMPY-LIKE; STPL; WOX9B;
                     WUSCHEL related homeobox 8; WUSCHEL related homeobox 9B"
                     /inference="Similar to RNA sequence,
                     EST:INSD:DR750890.1,INSD:AV557790.1,INSD:DR750889.1,
                     INSD:AV556647.1"
                     /inference="similar to RNA sequence, mRNA:INSD:AY251400.1"
                     /note="WUSCHEL related homeobox 8 (WOX8); CONTAINS
                     InterPro DOMAIN/s: Homeobox (InterPro:IPR001356),
                     Homeodomain-like (InterPro:IPR009057); BEST Arabidopsis
                     thaliana protein match is: homeobox-3 (TAIR:AT2G33880.1);
                     Has 568 Blast hits to 538 proteins in 48 species: Archae -
                     0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 568;
                     Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink)."
                     /codon_start=1
                     /product="WUSCHEL related homeobox 8"
                     /protein_id="NP_199410.2"
                     /db_xref="GeneID:834638"
                     /db_xref="TAIR:AT5G45980"
                     /db_xref="Araport:AT5G45980"
                     /translation="
MSSSNKNWPSMFKSKPCNNNHHHQHEIDTPSYMHYSNCNLSSSFSSDRIPDPKPRWNPKPEQIRILESIFNSGTINPPREEIQRIRIRLQEYGQIGDANVFYWFQNRKSRAKHKLRVHHKSPKMSKKDKTVIPSTDADHCFGFVNQETGLYPVQNNELVVTEPAGFLFPVHNDPSAAQSAFGFGDFVVPVVTEEGMAFSTVNNGVNLETNENFDKIPAINLYGGDGNGGGNCFPPLTVPLTINQSQEKRDVGLSGGEDVGDNVYPVRMTVFINEMPIEVVSGLFNVKAAFGNDAVLINSFGQPILTDEFGVTYQPLQNGAIYYLI"
     misc_feature    order(189..203,207..209,261..263,279..281,330..332,
                     336..341,348..353,363..371,375..377)
                     /gene="WOX8"
                     /locus_tag="AT5G45980"
                     /gene_synonym="MCL19.2; MCL19_2; STIMPY-LIKE; STPL; WOX9B;
                     WUSCHEL related homeobox 8; WUSCHEL related homeobox 9B"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    195..377
                     /gene="WOX8"
                     /locus_tag="AT5G45980"
                     /gene_synonym="MCL19.2; MCL19_2; STIMPY-LIKE; STPL; WOX9B;
                     WUSCHEL related homeobox 8; WUSCHEL related homeobox 9B"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     misc_feature    order(195..197,204..206,339..341,348..353,366..368)
                     /gene="WOX8"
                     /locus_tag="AT5G45980"
                     /gene_synonym="MCL19.2; MCL19_2; STIMPY-LIKE; STPL; WOX9B;
                     WUSCHEL related homeobox 8; WUSCHEL related homeobox 9B"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
ORIGIN      
ctttagctctcgattatcatcattacaccatcatcatgtcctcctcaaacaaaaattggccaagcatgttcaaatccaaaccttgcaacaataatcatcatcatcaacatgaaatcgatactccatcttacatgcactactctaattgcaacctatcatcttccttttcctcagatcggataccagatcctaaaccgagatggaatcctaaaccggagcagattaggatactcgaatcaatcttcaattccggtactattaacccacctagagaggagattcaaagaatccggatccggcttcaagaatatggtcaaatcggtgacgcaaacgtgttttactggtttcaaaaccggaaatctcgagcaaaacacaagcttcgtgttcatcacaaaagccctaaaatgtcaaagaaggacaagacggttattcctagtactgacgctgatcattgttttggttttgttaaccaagaaaccggattatatccggttcaaaacaatgagttggtggtaaccgaaccggccggttttctatttccggttcataatgatccgagcgctgctcaatcagcgtttggttttggcgattttgttgtaccggtggtaacggaagaagggatggcattctctaccgttaataacggcgttaatttggagactaacgaaaattttgataaaattccggcgatcaatttatacggcggagatggaaatggcggtggaaattgttttcctcctttgactgttccattaaccatcaatcaatctcaagaaaaacgagatgtaggattatccggtggtgaagacgtcggagataatgtttatccggtgagaatgacggtgtttattaacgagatgcctatcgaagtagtgtctggattattcaacgttaaggcagctttcggaaacgatgccgttttgatcaactcgtttggccagcctattcttacagatgaatttggtgttacttatcaacctctccaaaatggcgcaatctattatcttatttagaagatattgaaaagcaaatgttatggtgctatggataaatattaatataataataaaagatttctgcgatttatttagttattaattatataagaatttcatttcttatcttttaaatttatgaacaatttacaggac
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]