LOCUS       XM_021467783             857 bp    mRNA    linear   VRT 08-SEP-2024
DEFINITION  PREDICTED: Danio rerio epidermal growth factor receptor pathway
            substrate 8b (eps8b), mRNA.
ACCESSION   XM_021467783
VERSION     XM_021467783.2
DBLINK      BioProject: PRJNA13922
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_007129.7) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Sep 8, 2024 this sequence version replaced XM_021467783.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_000002035.6-RS_2024_08
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 08/15/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..857
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /strain="Tuebingen"
                     /db_xref="taxon:7955"
                     /chromosome="18"
     gene            1..857
                     /gene="eps8b"
                     /note="epidermal growth factor receptor pathway substrate
                     8b; Derived by automated computational analysis using gene
                     prediction method: Gnomon. Supporting evidence includes
                     similarity to: 1 EST, and 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 1 sample
                     with support for all annotated introns"
                     /db_xref="GeneID:564779"
                     /db_xref="ZFIN:ZDB-GENE-060503-164"
     CDS             58..777
                     /gene="eps8b"
                     /codon_start=1
                     /product="epidermal growth factor receptor kinase
                     substrate 8-like protein 2"
                     /protein_id="XP_021323458.1"
                     /db_xref="GeneID:564779"
                     /db_xref="ZFIN:ZDB-GENE-060503-164"
                     /translation="

MLEPSNSDLQHVRIRYHFVARNANELTVQQGDELEVLENNQQWWLLRNRSGQSGYVPCNVLEEVKPEEQQYNRAALFSSQAVNPYKGTTTSPVPVNHAVVLEMNKSSRDKDNRDQQKEVNDELLKRITDNKAQPPARNFRVERSSRSIRITDESQPFEVHAWLNAKGFSRPVVECLGILNGAQLFSLSKDELKAVCGDEGSRVYSQITVQKAQIERGNGDTELQEIMRRRQQEVDSTWD"

     misc_feature    91..249
                     /gene="eps8b"
                     /note="Src Homology 3 domain superfamily; Region: SH3;
                     cl17036"
                     /db_xref="CDD:473055"
     misc_feature    order(103..105,109..111,118..120,130..132,181..186,
                     226..228,232..237)
                     /gene="eps8b"
                     /note="peptide ligand binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:212690"
     misc_feature    505..699
                     /gene="eps8b"
                     /note="SAM domain of EPS8-like subfamily; Region:
                     SAM_EPS8-like; cd09540"
                     /db_xref="CDD:188939"
ORIGIN      

cgcagcggctcacggcgcgcttgtagcaaagccatcggcaggctcttctgaaaaaccatgctcgagccgtctaacagcgacctccaacatgtcaggatccgttatcactttgtggcgcgcaatgccaacgagctcacggtgcagcagggcgatgagctggaggtcttggaaaacaaccaacagtggtggttattgaggaaccgcagtggtcagtcaggctatgtgccatgtaatgtgctggaagaggtcaaaccagaagagcagcagtacaaccgagcagctctattcagcagccaggctgtgaatccttacaaaggtaccaccaccagccctgtacctgtaaatcacgccgtggttttggagatgaataaatcctcccgggataaagataaccgcgaccagcaaaaggaggtaaacgatgagctgctgaagaggataacagacaataaagctcaacctccggctcgaaacttccgggtggaacgctctagcagatccattcgcatcacagatgaatcgcagccctttgaggtccacgcttggctcaatgcgaagggattttctaggccggtggtggagtgtctggggatcctgaacggagctcaactcttctctctgagtaaggatgagctgaaagctgtgtgcggggacgagggttcacgtgtctacagtcagatcaccgtgcagaaagctcaaatagagaggggtaatggcgatacagagctacaggagatcatgaggcgacggcaacaggaggtggactcaacctgggactgattacagtcaatcatggccttatttcatcacgttttcttcaatgctcttgttcaccctacaatcaacagccacccagagga

//