LOCUS       XM_009301860             718 bp    mRNA    linear   VRT 08-SEP-2024
DEFINITION  PREDICTED: Danio rerio HOATZ cilia and flagella associated protein
            (hoatz), transcript variant X1, mRNA.
ACCESSION   XM_009301860
VERSION     XM_009301860.4
DBLINK      BioProject: PRJNA13922
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_007116.7) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Sep 8, 2024 this sequence version replaced XM_009301860.3.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_000002035.6-RS_2024_08
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 08/15/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..718
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /strain="Tuebingen"
                     /db_xref="taxon:7955"
                     /chromosome="5"
     gene            1..718
                     /gene="hoatz"
                     /gene_synonym="si:dkey-27p23.3"
                     /note="HOATZ cilia and flagella associated protein;
                     Derived by automated computational analysis using gene
                     prediction method: Gnomon. Supporting evidence includes
                     similarity to: 2 ESTs, 1 Protein, and 100% coverage of the
                     annotated genomic feature by RNAseq alignments, including
                     3 samples with support for all annotated introns"
                     /db_xref="GeneID:566423"
                     /db_xref="ZFIN:ZDB-GENE-070705-453"
     misc_feature    1
                     /gene="hoatz"
                     /gene_synonym="si:dkey-27p23.3"
                     /experiment="COORDINATES: cap analysis [ECO:0007248]"
                     /note="transcription start site"
     CDS             65..670
                     /gene="hoatz"
                     /gene_synonym="si:dkey-27p23.3"
                     /codon_start=1
                     /product="cilia- and flagella-associated protein HOATZ
                     isoform X1"
                     /protein_id="XP_009300135.1"
                     /db_xref="GeneID:566423"
                     /db_xref="ZFIN:ZDB-GENE-070705-453"
                     /translation="

MSEELDEEVLDGLTEVEKLYTVFHGASQEDVAYAKLFWNSLSLQPPIESRLVSSDIRQRLKVAKTPNTTNAAANQAPWSKRNEEIQQDAYLRQKQEEKQRYMEMAKNRDQIIALLKKQRDERIKAMTLLLESLVSVVLLESDQLWYYTKTRYILYSILCLLCCVLSFIVLLKDELTLHFCIHRSLNLDYSTSFCCWKTLLL"

     misc_feature    68..>436
                     /gene="hoatz"
                     /gene_synonym="si:dkey-27p23.3"
                     /note="Cilia- and flagella-associated protein HOATZ-like;
                     Region: HOATZ-like; pfam17664"
                     /db_xref="CDD:465445"
ORIGIN      

actagtgaggggttaccttggtaacggcaatacacatgtaacggctacctattgcttgcaaaccatgagtgaagaactagacgaagaggttttagacggtcttacagaagtcgaaaaattgtatacagtttttcatggagcgtcgcaagaagatgtggcgtacgcaaagcttttctggaattctctttctcttcaaccaccgatagagtcccgtctcgtttcttccgacatcagacagcgcttaaaagttgcgaaaaccccgaacaccacaaatgctgctgcaaatcaagcgccatggtcaaagaggaatgaggaaatccaacaagatgcttacctgaggcaaaagcaggaggagaagcagagatacatggagatggcaaaaaatcgagaccagattatcgcccttctgaaaaagcagagggatgaacgaattaaggcaatgactctgcttcttgaatcactggtgagtgtggtgttacttgagtctgatcaactctggtattacacaaagacccgatatatattatatagtatcctttgccttctttgctgtgtacttagtttcattgtcttgttgaaagatgaactgactctgcatttctgcattcatcgttccttaaatcttgactattccaccagcttctgctgttggaaaacattgctactgtaggaatgggtttggctaggtgttggagttgtatctggttttctccagacc

//