LOCUS       XM_003200793            1005 bp    mRNA    linear   VRT 08-SEP-2024
DEFINITION  PREDICTED: Danio rerio gonadal somatic cell derived factor (gsdf),
            transcript variant X1, mRNA.
ACCESSION   XM_003200793
VERSION     XM_003200793.6
DBLINK      BioProject: PRJNA13922
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_007132.7) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Sep 8, 2024 this sequence version replaced XM_003200793.5.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_000002035.6-RS_2024_08
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 08/15/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1005
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /strain="Tuebingen"
                     /db_xref="taxon:7955"
                     /chromosome="21"
     gene            1..1005
                     /gene="gsdf"
                     /note="gonadal somatic cell derived factor; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 57 ESTs, and 100% coverage of the annotated genomic
                     feature by RNAseq alignments, including 136 samples with
                     support for all annotated introns"
                     /db_xref="GeneID:571289"
                     /db_xref="ZFIN:ZDB-GENE-101029-3"
     CDS             140..703
                     /gene="gsdf"
                     /codon_start=1
                     /product="gonadal somatic cell derived factor isoform X1"
                     /protein_id="XP_003200841.1"
                     /db_xref="GeneID:571289"
                     /db_xref="ZFIN:ZDB-GENE-101029-3"
                     /translation="

MVCVCLPCVRWAPLLALLVCVFAQDSSRECLDKDELIAEMPSTVDLPTECVLTCTALTYRQILDTQRRVTVRFRDSRPGEDRDEFCWLISSRCSTWDEVLVLLSLSQSDAATEARIRLQTDSLILVEPQDSPSVLPDDCGLRFDVTAQLQGLRQHTLCVRPHGIMGNQLQCPPALVFVKQKQKESRS"

     polyA_site      1005
                     /gene="gsdf"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      

gtgtgtgtgtgttcctccaaggctgttgcgcactcagtaaagcctctctctttctgtgcgagtgtgtgtgtgtgacccttagagctgatgggctccgctgagcctcgacattaatcagacaacagcagcgaccgacagcatggtgtgtgtgtgtttgccctgtgtgcgctgggcaccgctgctggcgctgctggtgtgtgtgtttgctcaggacagcagccgggagtgtttggacaaggacgagctcattgctgaaatgcccagcactgtggacctcccgacggagtgtgtgctgacctgcaccgcgctcacgtaccggcagatcctggacacacagcgcagggtcacggtgcgcttcagggactcgcggcccggtgaagacagagacgagttctgctggcttatcagcagcagatgcagcacgtgggatgaagtgttggttttactgtctctcagccaatcagacgcggcgaccgaagccaggattcgtcttcagaccgactccctgatcctcgtggagccgcaagactctccgtccgtcctgcctgatgactgcggcctgcggttcgacgtcaccgcgcaactgcaaggcctgcgacagcacacgctctgcgtcaggccgcacggcatcatgggaaaccagctgcagtgtccgccggctctggtcttcgtaaagcagaaacagaaagagagtcgctcctgatccagaccacgaacattacgacacgcagcgctgaacccttcctggtgatggaaaacgcaactcatttcaagtttctgaatgtttcagtaatatgtaaataataatctatatttccatttgaatatacttaatgtaatttacattataatcgttctattatagcaaactgataaatctctagaatacagtgcactcgcatcttttactctgtaataaagatttcctatatagatacagatatatataaccttattatatgtacccatattcagctattttgttaataaaattatggaagctca

//