ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-24 02:35:27, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NR_045221 136 bp RNA linear VRT 07-JUN-2025
DEFINITION Danio rerio microRNA 9-2 (mir9-2), microRNA.
ACCESSION NR_045221
VERSION NR_045221.1
KEYWORDS RefSeq.
SOURCE Danio rerio (zebrafish)
ORGANISM Danio rerio
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE 1 (bases 1 to 136)
AUTHORS Madelaine,R., Notwell,J.H., Skariah,G., Halluin,C., Chen,C.C.,
Bejerano,G. and Mourrain,P.
TITLE A screen for deeply conserved non-coding GWAS SNPs uncovers a
MIR-9-2 functional mutation associated to retinal vasculature
defects in human
JOURNAL Nucleic Acids Res 46 (7), 3517-3531 (2018)
PUBMED 29518216
REMARK GeneRIF: Furthermore, deletion of CNE1 led to retinal vasculature
defects and to a specific downregulation of microRNA-9, rather than
MEF2C as predicted by the original genome-wide association
REFERENCE 2 (bases 1 to 136)
AUTHORS Katz,S., Cussigh,D., Urban,N., Blomfield,I., Guillemot,F.,
Bally-Cuif,L. and Coolen,M.
TITLE A Nuclear Role for miR-9 and Argonaute Proteins in Balancing
Quiescent and Activated Neural Stem Cell States
JOURNAL Cell Rep 17 (5), 1383-1398 (2016)
PUBMED 27783951
REFERENCE 3 (bases 1 to 136)
AUTHORS King,B.L. and Yin,V.P.
TITLE A Conserved MicroRNA Regulatory Circuit Is Differentially
Controlled during Limb/Appendage Regeneration
JOURNAL PLoS One 11 (6), e0157106 (2016)
PUBMED 27355827
REMARK Publication Status: Online-Only
REFERENCE 4 (bases 1 to 136)
AUTHORS Nepal,C., Coolen,M., Hadzhiev,Y., Cussigh,D., Mydel,P., Steen,V.M.,
Carninci,P., Andersen,J.B., Bally-Cuif,L., Muller,F. and Lenhard,B.
TITLE Transcriptional, post-transcriptional and chromatin-associated
regulation of pri-miRNAs, pre-miRNAs and moRNAs
JOURNAL Nucleic Acids Res 44 (7), 3070-3081 (2016)
PUBMED 26673698
REFERENCE 5 (bases 1 to 136)
AUTHORS Ristori,E., Lopez-Ramirez,M.A., Narayanan,A., Hill-Teran,G.,
Moro,A., Calvo,C.F., Thomas,J.L. and Nicoli,S.
TITLE A Dicer-miR-107 Interaction Regulates Biogenesis of Specific miRNAs
Crucial for Neurogenesis
JOURNAL Dev Cell 32 (5), 546-560 (2015)
PUBMED 25662174
REFERENCE 6 (bases 1 to 136)
AUTHORS Leucht,C., Stigloher,C., Wizenmann,A., Klafke,R., Folchert,A. and
Bally-Cuif,L.
TITLE MicroRNA-9 directs late organizer activity of the
midbrain-hindbrain boundary
JOURNAL Nat Neurosci 11 (6), 641-648 (2008)
PUBMED 18454145
REFERENCE 7 (bases 1 to 136)
AUTHORS Kapsimali,M., Kloosterman,W.P., de Bruijn,E., Rosa,F.,
Plasterk,R.H. and Wilson,S.W.
TITLE MicroRNAs show a wide diversity of expression profiles in the
developing and mature central nervous system
JOURNAL Genome Biol 8 (8), R173 (2007)
PUBMED 17711588
REFERENCE 8 (bases 1 to 136)
AUTHORS Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
Enright,A.J.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
REFERENCE 9 (bases 1 to 136)
AUTHORS Wienholds,E., Kloosterman,W.P., Miska,E., Alvarez-Saavedra,E.,
Berezikov,E., de Bruijn,E., Horvitz,H.R., Kauppinen,S. and
Plasterk,R.H.
TITLE MicroRNA expression in zebrafish embryonic development
JOURNAL Science 309 (5732), 310-311 (2005)
PUBMED 15919954
REFERENCE 10 (bases 1 to 136)
AUTHORS Chen,P.Y., Manninga,H., Slanchev,K., Chien,M., Russo,J.J., Ju,J.,
Sheridan,R., John,B., Marks,D.S., Gaidatzis,D., Sander,C.,
Zavolan,M. and Tuschl,T.
TITLE The developmental miRNA profiles of zebrafish as determined by
small RNA cloning
JOURNAL Genes Dev 19 (11), 1288-1293 (2005)
PUBMED 15937218
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from JBMGRA010000010.1.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript is intronless :: LM609095.1 [ECO:0000345]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-136 JBMGRA010000010.1 48799385-48799520 c
FEATURES Location/Qualifiers
source 1..136
/organism="Danio rerio"
/mol_type="transcribed RNA"
/strain="Tuebingen"
/db_xref="taxon:7955"
/chromosome="10"
/map="10"
gene 1..136
/gene="mir9-2"
/gene_synonym="mirn9-2"
/note="microRNA 9-2"
/db_xref="GeneID:100191017"
/db_xref="miRBase:MI0001881"
/db_xref="ZFIN:ZDB-MIRNAG-081013-1"
precursor_RNA 1..136
/gene="mir9-2"
/gene_synonym="mirn9-2"
/product="microRNA 9-2"
/db_xref="GeneID:100191017"
/db_xref="miRBase:MI0001881"
/db_xref="ZFIN:ZDB-MIRNAG-081013-1"
exon 1..136
/gene="mir9-2"
/gene_synonym="mirn9-2"
/inference="alignment:Splign:2.1.0"
ncRNA 42..64
/ncRNA_class="miRNA"
/gene="mir9-2"
/gene_synonym="mirn9-2"
/product="dre-miR-9-5p"
/db_xref="miRBase:MIMAT0001769"
/db_xref="GeneID:100191017"
/db_xref="miRBase:MI0001881"
/db_xref="ZFIN:ZDB-MIRNAG-081013-1"
ncRNA 80..100
/ncRNA_class="miRNA"
/gene="mir9-2"
/gene_synonym="mirn9-2"
/product="dre-miR-9-3p"
/db_xref="miRBase:MIMAT0003156"
/db_xref="GeneID:100191017"
/db_xref="miRBase:MI0001881"
/db_xref="ZFIN:ZDB-MIRNAG-081013-1"
ORIGIN
gctctcctctggtgacttttgcacttggaggcgtgttgttatctttggttatctagctgtatgagtgtgctggccgtcataaagctagataaccgaaagtaagagccgcttctatcagcaacgtatggagcattgc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]