LOCUS       NR_045221                136 bp    RNA     linear   VRT 18-OCT-2021
DEFINITION  Danio rerio microRNA 9-2 (mir9-2), microRNA.
ACCESSION   NR_045221
VERSION     NR_045221.1
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 136)
  AUTHORS   Madelaine R, Notwell JH, Skariah G, Halluin C, Chen CC, Bejerano G
            and Mourrain P.
  TITLE     A screen for deeply conserved non-coding GWAS SNPs uncovers a
            MIR-9-2 functional mutation associated to retinal vasculature
            defects in human
  JOURNAL   Nucleic Acids Res 46 (7), 3517-3531 (2018)
   PUBMED   29518216
  REMARK    GeneRIF: Furthermore, deletion of CNE1 led to retinal vasculature
            defects and to a specific downregulation of microRNA-9, rather than
            MEF2C as predicted by the original genome-wide association
REFERENCE   2  (bases 1 to 136)
  AUTHORS   Katz S, Cussigh D, Urban N, Blomfield I, Guillemot F, Bally-Cuif L
            and Coolen M.
  TITLE     A Nuclear Role for miR-9 and Argonaute Proteins in Balancing
            Quiescent and Activated Neural Stem Cell States
  JOURNAL   Cell Rep 17 (5), 1383-1398 (2016)
   PUBMED   27783951
REFERENCE   3  (bases 1 to 136)
  AUTHORS   King BL and Yin VP.
  TITLE     A Conserved MicroRNA Regulatory Circuit Is Differentially
            Controlled during Limb/Appendage Regeneration
  JOURNAL   PLoS One 11 (6), e0157106 (2016)
   PUBMED   27355827
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 136)
  AUTHORS   Nepal C, Coolen M, Hadzhiev Y, Cussigh D, Mydel P, Steen VM,
            Carninci P, Andersen JB, Bally-Cuif L, Muller F and Lenhard B.
  TITLE     Transcriptional, post-transcriptional and chromatin-associated
            regulation of pri-miRNAs, pre-miRNAs and moRNAs
  JOURNAL   Nucleic Acids Res 44 (7), 3070-3081 (2016)
   PUBMED   26673698
REFERENCE   5  (bases 1 to 136)
  AUTHORS   Ristori E, Lopez-Ramirez MA, Narayanan A, Hill-Teran G, Moro A,
            Calvo CF, Thomas JL and Nicoli S.
  TITLE     A Dicer-miR-107 Interaction Regulates Biogenesis of Specific miRNAs
            Crucial for Neurogenesis
  JOURNAL   Dev Cell 32 (5), 546-560 (2015)
   PUBMED   25662174
REFERENCE   6  (bases 1 to 136)
  AUTHORS   Leucht C, Stigloher C, Wizenmann A, Klafke R, Folchert A and
            Bally-Cuif L.
  TITLE     MicroRNA-9 directs late organizer activity of the
            midbrain-hindbrain boundary
  JOURNAL   Nat Neurosci 11 (6), 641-648 (2008)
   PUBMED   18454145
REFERENCE   7  (bases 1 to 136)
  AUTHORS   Kapsimali M, Kloosterman WP, de Bruijn E, Rosa F, Plasterk RH and
            Wilson SW.
  TITLE     MicroRNAs show a wide diversity of expression profiles in the
            developing and mature central nervous system
  JOURNAL   Genome Biol 8 (8), R173 (2007)
   PUBMED   17711588
REFERENCE   8  (bases 1 to 136)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
REFERENCE   9  (bases 1 to 136)
  AUTHORS   Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov
            E, de Bruijn E, Horvitz HR, Kauppinen S and Plasterk RH.
  TITLE     MicroRNA expression in zebrafish embryonic development
  JOURNAL   Science 309 (5732), 310-311 (2005)
   PUBMED   15919954
REFERENCE   10 (bases 1 to 136)
  AUTHORS   Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan
            R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M and Tuschl T.
  TITLE     The developmental miRNA profiles of zebrafish as determined by
            small RNA cloning
  JOURNAL   Genes Dev 19 (11), 1288-1293 (2005)
   PUBMED   15937218
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from CU462873.19.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript is intronless :: LM609095.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-136               CU462873.19        8856-8991
FEATURES             Location/Qualifiers
     source          1..136
                     /organism="Danio rerio"
                     /mol_type="transcribed RNA"
                     /strain="Tuebingen"
                     /db_xref="taxon:7955"
                     /chromosome="10"
                     /map="10"
     gene            1..136
                     /gene="mir9-2"
                     /gene_synonym="mirn9-2"
                     /note="microRNA 9-2"
                     /db_xref="GeneID:100191017"
                     /db_xref="miRBase:MI0001881"
                     /db_xref="ZFIN:ZDB-MIRNAG-081013-1"
     precursor_RNA   1..136
                     /gene="mir9-2"
                     /gene_synonym="mirn9-2"
                     /product="microRNA 9-2"
                     /db_xref="GeneID:100191017"
                     /db_xref="miRBase:MI0001881"
                     /db_xref="ZFIN:ZDB-MIRNAG-081013-1"
     exon            1..136
                     /gene="mir9-2"
                     /gene_synonym="mirn9-2"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           42..64
                     /ncRNA_class="miRNA"
                     /gene="mir9-2"
                     /gene_synonym="mirn9-2"
                     /product="dre-miR-9-5p"
                     /db_xref="miRBase:MIMAT0001769"
                     /db_xref="GeneID:100191017"
                     /db_xref="miRBase:MI0001881"
                     /db_xref="ZFIN:ZDB-MIRNAG-081013-1"
     ncRNA           80..100
                     /ncRNA_class="miRNA"
                     /gene="mir9-2"
                     /gene_synonym="mirn9-2"
                     /product="dre-miR-9-3p"
                     /db_xref="miRBase:MIMAT0003156"
                     /db_xref="GeneID:100191017"
                     /db_xref="miRBase:MI0001881"
                     /db_xref="ZFIN:ZDB-MIRNAG-081013-1"
ORIGIN      

gctctcctctggtgacttttgcacttggaggcgtgttgttatctttggttatctagctgtatgagtgtgctggccgtcataaagctagataaccgaaagtaagagccgcttctatcagcaacgtatggagcattgc

//