GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-08-24 02:12:00, GGRNA.v2 : RefSeq release 230 (May, 2025)

LOCUS       NM_131700               1298 bp    mRNA    linear   VRT 06-APR-2025
DEFINITION  Danio rerio ventral expressed homeobox (vent), mRNA.
ACCESSION   NM_131700
VERSION     NM_131700.1
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 1298)
  AUTHORS   Li,Y., Yan,Y., Gong,B., Zheng,Q., Zhou,H., Sun,J., Li,M., Wang,Z.,
            Li,Y., Wan,Y., Chen,W., Qi,S., Mo,X., Meng,A., Xiang,B. and Chen,J.
  TITLE     A Huluwa phosphorylation switch regulates embryonic axis induction
  JOURNAL   Nat Commun 15 (1), 10028 (2024)
   PUBMED   39562571
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1298)
  AUTHORS   Mao,A., Li,Z., Ning,G., Zhou,Z., Wei,C., Li,J., He,X. and Wang,Q.
  TITLE     Sclerotome-derived PDGF signaling functions as a niche cue
            responsible for primitive erythropoiesis
  JOURNAL   Development 150 (22) (2023)
   PUBMED   37882745
REFERENCE   3  (bases 1 to 1298)
  AUTHORS   Zhang,W., Scerbo,P., Delagrange,M., Candat,V., Mayr,V., Vriz,S.,
            Distel,M., Ducos,B. and Bensimon,D.
  TITLE     Fgf8 dynamics and critical slowing down may account for the
            temperature independence of somitogenesis
  JOURNAL   Commun Biol 5 (1), 113 (2022)
   PUBMED   35132142
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 1298)
  AUTHORS   Wang,B., Rong,X., Zhou,Y., Liu,Y., Sun,J., Zhao,B., Deng,B., Lu,L.,
            Lu,L., Li,Y. and Zhou,J.
  TITLE     Eukaryotic initiation factor 4A3 inhibits Wnt/beta-catenin
            signaling and regulates axis formation in zebrafish embryos
  JOURNAL   Development 148 (9) (2021)
   PUBMED   33914867
REFERENCE   5  (bases 1 to 1298)
  AUTHORS   Lin,C.Y., Lu,M.J., Yue,J.X., Li,K.L., Le Petillon,Y., Yong,L.W.,
            Chen,Y.H., Tsai,F.Y., Lyu,Y.F., Chen,C.Y., Hwang,S.L., Su,Y.H. and
            Yu,J.K.
  TITLE     Molecular asymmetry in the cephalochordate embryo revealed by
            single-blastomere transcriptome profiling
  JOURNAL   PLoS Genet 16 (12), e1009294 (2020)
   PUBMED   33382716
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 1298)
  AUTHORS   Gilardelli,C.N., Pozzoli,O., Sordino,P., Matassi,G. and Cotelli,F.
  TITLE     Functional and hierarchical interactions among zebrafish vox/vent
            homeobox genes
  JOURNAL   Dev Dyn 230 (3), 494-508 (2004)
   PUBMED   15188434
  REMARK    GeneRIF: vent plays a critical role in the development of the
            dorsoventral axis.
REFERENCE   7  (bases 1 to 1298)
  AUTHORS   Tsang,M., Maegawa,S., Kiang,A., Habas,R., Weinberg,E. and
            Dawid,I.B.
  TITLE     A role for MKP3 in axial patterning of the zebrafish embryo
  JOURNAL   Development 131 (12), 2769-2779 (2004)
   PUBMED   15142973
REFERENCE   8  (bases 1 to 1298)
  AUTHORS   Sidi,S., Goutel,C., Peyrieras,N. and Rosa,F.M.
  TITLE     Maternal induction of ventral fate by zebrafish radar
  JOURNAL   Proc Natl Acad Sci U S A 100 (6), 3315-3320 (2003)
   PUBMED   12601179
REFERENCE   9  (bases 1 to 1298)
  AUTHORS   Shimizu,T., Yamanaka,Y., Nojima,H., Yabe,T., Hibi,M. and Hirano,T.
  TITLE     A novel repressor-type homeobox gene, ved, is involved in
            dharma/bozozok-mediated dorsal organizer formation in zebrafish
  JOURNAL   Mech Dev 118 (1-2), 125-138 (2002)
   PUBMED   12351176
  REMARK    GeneRIF: ved functions redundantly with vox/vega1 and vent/vega2 to
            restrict the organizer domain in zebrafish
REFERENCE   10 (bases 1 to 1298)
  AUTHORS   Imai,Y., Gates,M.A., Melby,A.E., Kimelman,D., Schier,A.F. and
            Talbot,W.S.
  TITLE     The homeobox genes vox and vent are redundant repressors of dorsal
            fates in zebrafish
  JOURNAL   Development 128 (12), 2407-2420 (2001)
   PUBMED   11493559
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AF255044.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF255044.1, AW128696.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA898401, SAMN06645146
                                           [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1298
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /db_xref="taxon:7955"
                     /chromosome="13"
                     /map="13"
     gene            1..1298
                     /gene="vent"
                     /gene_synonym="vega2; vent1; wu:fe36b11"
                     /note="ventral expressed homeobox"
                     /db_xref="GeneID:64810"
                     /db_xref="ZFIN:ZDB-GENE-010108-2"
     misc_feature    70..72
                     /gene="vent"
                     /gene_synonym="vega2; vent1; wu:fe36b11"
                     /note="upstream in-frame stop codon"
     CDS             88..600
                     /gene="vent"
                     /gene_synonym="vega2; vent1; wu:fe36b11"
                     /codon_start=1
                     /product="ventral expressed homeobox"
                     /protein_id="NP_571775.1"
                     /db_xref="GeneID:64810"
                     /db_xref="ZFIN:ZDB-GENE-010108-2"
                     /translation="
MIPSKFSVEWLSQSFHDQEKCSTAAPGAPLTAAAGAGKAPASPANSCGYTDVESDDSEVEAGQNRRVRTKFTCDQISGLEKSFSKHRYLGATQRRKIAEKLHLSETQVKTWFQNRRMKLKREVQDMRAADFLYPAVFPPMTSLQHQSVGYYHQQQPQHITHPMLFTRCYF"
     misc_feature    280..450
                     /gene="vent"
                     /gene_synonym="vega2; vent1; wu:fe36b11"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
ORIGIN      
ggcacgagggcgcctccataaagtctacagacctcttgaggacttctaaacacgctttttcttcttctttagcccagaacaagcatcatgatacccagcaagttctcagtggagtggctctcccagagtttccatgatcaggagaaatgcagcacagcagctcctggagctccactaacagcggctgcaggagcagggaaggccccggcgtcacccgccaacagctgtggatacaccgatgtggagagtgatgacagtgaagtagaagcggggcagaatcgacgcgtcaggaccaaattcacctgcgatcagatctctggcctggagaagagcttcagcaaacaccgctacctcggagcaactcagaggaggaagatagcggagaaactgcacctgtcagaaactcaggtgaagacgtggtttcagaaccggcggatgaagctgaagcgtgaggtgcaggacatgcgtgccgcagacttcctctatcccgctgtttttccaccgatgacgtcacttcagcaccaaagcgtggggtactaccaccagcagcagccgcagcacatcacacacccgatgctgttcacacgctgctacttctaaacgtctcctgtgtggaattatatttgtgcgataattctatgcacaaaaggtcatgttttgagtacacaaagtcatcatgatcttatgtgtgcaaaattgttaacaaacatgcaatgtcactttacatgctcaaaacatgactttttgcatgcagacttgttaacatgcacacaacctgcaatttttcaagctcaaaacatgatcttttgcatgcaaaattgttaacacacatgcaacaagccattttggatggtcaaaacaggatcttatgtgtgcaagttgttcacacacacacaaccggcgattttgcatgctcaaaacatgatcttttgaacaaagaattgttaacgcgcatgcaacaagtcattttacatgctcaaaacatgatcttttgtgtgcaaaattgttaattgacttgcaacaaggcattttacatgctcaagacaggatttttttgcatgcaaaattgttacactcatgcaacaagtcattttggatgcttaaagcatgatcttttgcatgaaaaattgttagcgcacatgcaaccagcaattttgcacgctctaaacatgatctcttgcatgcagaattgttaacaaacatacaactagcaatttttttatgctcaaaaaatgatcttttgtgtgcaaaattgttaattgacttgcaacaaggcattttgcatgctcaagacagga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]