GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-07-12 16:29:02, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       NM_131545                852 bp    mRNA    linear   VRT 12-JAN-2025
DEFINITION  Danio rerio homeobox C12b (hoxc12b), mRNA.
ACCESSION   NM_131545
VERSION     NM_131545.1
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 852)
  AUTHORS   Adachi,U., Koita,R., Seto,A., Maeno,A., Ishizu,A., Oikawa,S.,
            Tani,T., Ishizaka,M., Yamada,K., Satoh,K., Nakazawa,H.,
            Furudate,H., Kawakami,K., Iwanami,N., Matsuda,M. and Kawamura,A.
  TITLE     Teleost Hox code defines regional identities competent for the
            formation of dorsal and anal fins
  JOURNAL   Proc Natl Acad Sci U S A 121 (25), e2403809121 (2024)
   PUBMED   38861596
REFERENCE   2  (bases 1 to 852)
  AUTHORS   Sundaramoorthi,H., Fallatah,W., Mary,J. and Jagadeeswaran,P.
  TITLE     Discovery of seven hox genes in zebrafish thrombopoiesis
  JOURNAL   Blood Cells Mol Dis 104, 102796 (2024)
   PUBMED   37717409
REFERENCE   3  (bases 1 to 852)
  AUTHORS   Yamada,K., Maeno,A., Araki,S., Kikuchi,M., Suzuki,M., Ishizaka,M.,
            Satoh,K., Akama,K., Kawabe,Y., Suzuki,K., Kobayashi,D., Hamano,N.
            and Kawamura,A.
  TITLE     An atlas of seven zebrafish hox cluster mutants provides insights
            into sub/neofunctionalization of vertebrate Hox clusters
  JOURNAL   Development 148 (11) (2021)
   PUBMED   34096572
REFERENCE   4  (bases 1 to 852)
  AUTHORS   Fouchecourt,S., Picolo,F., Elis,S., Lecureuil,C., Thelie,A.,
            Govoroun,M., Bregeon,M., Papillier,P., Lareyre,J.J. and Monget,P.
  TITLE     An evolutionary approach to recover genes predominantly expressed
            in the testes of the zebrafish, chicken and mouse
  JOURNAL   BMC Evol Biol 19 (1), 137 (2019)
   PUBMED   31269894
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 852)
  AUTHORS   Malmstrom,M., Britz,R., Matschiner,M., Torresen,O.K., Hadiaty,R.K.,
            Yaakob,N., Tan,H.H., Jakobsen,K.S., Salzburger,W. and Ruber,L.
  TITLE     The Most Developmentally Truncated Fishes Show Extensive Hox Gene
            Loss and Miniaturized Genomes
  JOURNAL   Genome Biol Evol 10 (4), 1088-1103 (2018)
   PUBMED   29684203
REFERENCE   6  (bases 1 to 852)
  AUTHORS   Kurosawa,G., Takamatsu,N., Takahashi,M., Sumitomo,M., Sanaka,E.,
            Yamada,K., Nishii,K., Matsuda,M., Asakawa,S., Ishiguro,H.,
            Miura,K., Kurosawa,Y., Shimizu,N., Kohara,Y. and Hori,H.
  TITLE     Organization and structure of hox gene loci in medaka genome and
            comparison with those of pufferfish and zebrafish genomes
  JOURNAL   Gene 370, 75-82 (2006)
   PUBMED   16472944
  REMARK    Erratum:[Gene. 2006 Jul;376(2):298-9]
REFERENCE   7  (bases 1 to 852)
  AUTHORS   Corredor-Adamez,M., Welten,M.C., Spaink,H.P., Jeffery,J.E.,
            Schoon,R.T., de Bakker,M.A., Bagowski,C.P., Meijer,A.H.,
            Verbeek,F.J. and Richardson,M.K.
  TITLE     Genomic annotation and transcriptome analysis of the zebrafish
            (Danio rerio) hox complex with description of a novel member, hox b
            13a
  JOURNAL   Evol Dev 7 (5), 362-375 (2005)
   PUBMED   16174031
REFERENCE   8  (bases 1 to 852)
  AUTHORS   Woods,I.G., Wilson,C., Friedlander,B., Chang,P., Reyes,D.K.,
            Nix,R., Kelly,P.D., Chu,F., Postlethwait,J.H. and Talbot,W.S.
  TITLE     The zebrafish gene map defines ancestral vertebrate chromosomes
  JOURNAL   Genome Res 15 (9), 1307-1314 (2005)
   PUBMED   16109975
REFERENCE   9  (bases 1 to 852)
  AUTHORS   Santini,S. and Bernardi,G.
  TITLE     Organization and base composition of tilapia Hox genes:
            implications for the evolution of Hox clusters in fish
  JOURNAL   Gene 346, 51-61 (2005)
   PUBMED   15716008
REFERENCE   10 (bases 1 to 852)
  AUTHORS   Thummel,R., Li,L., Tanase,C., Sarras,M.P. Jr. and Godwin,A.R.
  TITLE     Differences in expression pattern and function between zebrafish
            hoxc13 orthologs: recruitment of Hoxc13b into an early embryonic
            role
  JOURNAL   Dev Biol 274 (2), 318-333 (2004)
   PUBMED   15385162
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AF071260.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: FP212667.1, DQ060563.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA3505373, SAMEA3505374
                                           [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..852
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /db_xref="taxon:7955"
                     /chromosome="11"
                     /map="11"
     gene            1..852
                     /gene="hoxc12b"
                     /gene_synonym="sb:eu246"
                     /note="homeobox C12b"
                     /db_xref="GeneID:58062"
                     /db_xref="ZFIN:ZDB-GENE-000329-17"
     CDS             1..852
                     /gene="hoxc12b"
                     /gene_synonym="sb:eu246"
                     /note="homeo box C12b"
                     /codon_start=1
                     /product="homeobox protein Hox-C12b"
                     /protein_id="NP_571620.1"
                     /db_xref="GeneID:58062"
                     /db_xref="ZFIN:ZDB-GENE-000329-17"
                     /translation="
MGEHNLFNPGFVGQLVNINARDAFYLSNFRASGGQLAGLQTLRLSRRDNVCSLPWNPSEACSGYPQSHISGPVTLNHTYNQSCDITRQEDNKCFYSDSACATSGGGDNNSTNLISKEGALDNSSVSITAENGQNNLNGMDNGGSYSKYDCLTPAEQPIPNPRLCRSLESVSGCSFINEGAKTSSGITHSLTSPDIQTSVAALNGGALWYPMHRQTRKKRKPYSKLQLNELEGEFILNEFITRQRRRELSDRLNLTDQQVKIWFQNRRMKKKRLLMREQALSYF"
     misc_feature    646..816
                     /gene="hoxc12b"
                     /gene_synonym="sb:eu246"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     exon            1..613
                     /gene="hoxc12b"
                     /gene_synonym="sb:eu246"
                     /inference="alignment:Splign:2.1.0"
     exon            614..852
                     /gene="hoxc12b"
                     /gene_synonym="sb:eu246"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
atgggcgagcataatctctttaatccggggtttgttggacaattggttaacattaatgcaagagatgcattttacctctccaatttccgtgcgtcggggggacagctagcaggactgcaaaccctccgcttatccagaagagataatgtctgctctttgccttggaacccatcggaagcatgcagtggatacccacaatctcatattagcggccccgttaccctaaaccacacatacaatcaatcatgcgacattactcggcaggaagacaacaaatgtttttatagtgacagtgcatgcgccaccagcggcggtggtgacaataacagtaccaatcttatatcaaaagagggagcattggataactcatctgtatccattactgcagagaacggacagaacaatctgaacggaatggacaacggaggaagttattcaaaatatgactgcctgacacctgcagaacagcctatcccaaatcctcgtttgtgtcggtctcttgaatcggtttctggctgttcgttcataaacgagggggccaagacctcatcaggcatcacgcattcactaacatcccctgacatccaaacaagtgttgcagcactaaacggaggtgctctgtggtacccaatgcacagacaaactcgaaagaagcgtaaaccatattcaaaacttcagctgaacgagttggagggcgagttcatcctcaacgagttcatcaccagacagcggaggagggaactgtctgaccggctaaatctcacggaccaacaagtgaaaatctggttccaaaatcgtcgaatgaagaagaaaaggctcttgatgcgagagcaggctttatcttacttttag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]