ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-12-22 22:12:33, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NM_131545 852 bp mRNA linear VRT 02-APR-2025 DEFINITION Danio rerio homeobox C12b (hoxc12b), mRNA. ACCESSION NM_131545 VERSION NM_131545.1 KEYWORDS RefSeq. SOURCE Danio rerio (zebrafish) ORGANISM Danio rerio Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Danionidae; Danioninae; Danio. REFERENCE 1 (bases 1 to 852) AUTHORS Adachi,U., Koita,R., Seto,A., Maeno,A., Ishizu,A., Oikawa,S., Tani,T., Ishizaka,M., Yamada,K., Satoh,K., Nakazawa,H., Furudate,H., Kawakami,K., Iwanami,N., Matsuda,M. and Kawamura,A. TITLE Teleost Hox code defines regional identities competent for the formation of dorsal and anal fins JOURNAL Proc Natl Acad Sci U S A 121 (25), e2403809121 (2024) PUBMED 38861596 REFERENCE 2 (bases 1 to 852) AUTHORS Sundaramoorthi,H., Fallatah,W., Mary,J. and Jagadeeswaran,P. TITLE Discovery of seven hox genes in zebrafish thrombopoiesis JOURNAL Blood Cells Mol Dis 104, 102796 (2024) PUBMED 37717409 REFERENCE 3 (bases 1 to 852) AUTHORS Yamada,K., Maeno,A., Araki,S., Kikuchi,M., Suzuki,M., Ishizaka,M., Satoh,K., Akama,K., Kawabe,Y., Suzuki,K., Kobayashi,D., Hamano,N. and Kawamura,A. TITLE An atlas of seven zebrafish hox cluster mutants provides insights into sub/neofunctionalization of vertebrate Hox clusters JOURNAL Development 148 (11) (2021) PUBMED 34096572 REFERENCE 4 (bases 1 to 852) AUTHORS Fouchecourt,S., Picolo,F., Elis,S., Lecureuil,C., Thelie,A., Govoroun,M., Bregeon,M., Papillier,P., Lareyre,J.J. and Monget,P. TITLE An evolutionary approach to recover genes predominantly expressed in the testes of the zebrafish, chicken and mouse JOURNAL BMC Evol Biol 19 (1), 137 (2019) PUBMED 31269894 REMARK Publication Status: Online-Only REFERENCE 5 (bases 1 to 852) AUTHORS Malmstrom,M., Britz,R., Matschiner,M., Torresen,O.K., Hadiaty,R.K., Yaakob,N., Tan,H.H., Jakobsen,K.S., Salzburger,W. and Ruber,L. TITLE The Most Developmentally Truncated Fishes Show Extensive Hox Gene Loss and Miniaturized Genomes JOURNAL Genome Biol Evol 10 (4), 1088-1103 (2018) PUBMED 29684203 REFERENCE 6 (bases 1 to 852) AUTHORS Kurosawa,G., Takamatsu,N., Takahashi,M., Sumitomo,M., Sanaka,E., Yamada,K., Nishii,K., Matsuda,M., Asakawa,S., Ishiguro,H., Miura,K., Kurosawa,Y., Shimizu,N., Kohara,Y. and Hori,H. TITLE Organization and structure of hox gene loci in medaka genome and comparison with those of pufferfish and zebrafish genomes JOURNAL Gene 370, 75-82 (2006) PUBMED 16472944 REMARK Erratum:[Gene. 2006 Jul;376(2):298-9] REFERENCE 7 (bases 1 to 852) AUTHORS Corredor-Adamez,M., Welten,M.C., Spaink,H.P., Jeffery,J.E., Schoon,R.T., de Bakker,M.A., Bagowski,C.P., Meijer,A.H., Verbeek,F.J. and Richardson,M.K. TITLE Genomic annotation and transcriptome analysis of the zebrafish (Danio rerio) hox complex with description of a novel member, hox b 13a JOURNAL Evol Dev 7 (5), 362-375 (2005) PUBMED 16174031 REFERENCE 8 (bases 1 to 852) AUTHORS Woods,I.G., Wilson,C., Friedlander,B., Chang,P., Reyes,D.K., Nix,R., Kelly,P.D., Chu,F., Postlethwait,J.H. and Talbot,W.S. TITLE The zebrafish gene map defines ancestral vertebrate chromosomes JOURNAL Genome Res 15 (9), 1307-1314 (2005) PUBMED 16109975 REFERENCE 9 (bases 1 to 852) AUTHORS Santini,S. and Bernardi,G. TITLE Organization and base composition of tilapia Hox genes: implications for the evolution of Hox clusters in fish JOURNAL Gene 346, 51-61 (2005) PUBMED 15716008 REFERENCE 10 (bases 1 to 852) AUTHORS Thummel,R., Li,L., Tanase,C., Sarras,M.P. Jr. and Godwin,A.R. TITLE Differences in expression pattern and function between zebrafish hoxc13 orthologs: recruitment of Hoxc13b into an early embryonic role JOURNAL Dev Biol 274 (2), 318-333 (2004) PUBMED 15385162 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AF071260.1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: FP212667.1, DQ060563.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA3505373, SAMEA3505374 [ECO:0000348] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..852 /organism="Danio rerio" /mol_type="mRNA" /db_xref="taxon:7955" /chromosome="11" /map="11" gene 1..852 /gene="hoxc12b" /gene_synonym="sb:eu246" /note="homeobox C12b" /db_xref="GeneID:58062" /db_xref="ZFIN:ZDB-GENE-000329-17" CDS 1..852 /gene="hoxc12b" /gene_synonym="sb:eu246" /note="homeo box C12b" /codon_start=1 /product="homeobox protein Hox-C12b" /protein_id="NP_571620.1" /db_xref="GeneID:58062" /db_xref="ZFIN:ZDB-GENE-000329-17" /translation="
MGEHNLFNPGFVGQLVNINARDAFYLSNFRASGGQLAGLQTLRLSRRDNVCSLPWNPSEACSGYPQSHISGPVTLNHTYNQSCDITRQEDNKCFYSDSACATSGGGDNNSTNLISKEGALDNSSVSITAENGQNNLNGMDNGGSYSKYDCLTPAEQPIPNPRLCRSLESVSGCSFINEGAKTSSGITHSLTSPDIQTSVAALNGGALWYPMHRQTRKKRKPYSKLQLNELEGEFILNEFITRQRRRELSDRLNLTDQQVKIWFQNRRMKKKRLLMREQALSYF"
misc_feature 646..816
/gene="hoxc12b"
/gene_synonym="sb:eu246"
/note="Region: Homeodomain; pfam00046"
/db_xref="CDD:459649"
exon 1..613
/gene="hoxc12b"
/gene_synonym="sb:eu246"
/inference="alignment:Splign:2.1.0"
exon 614..852
/gene="hoxc12b"
/gene_synonym="sb:eu246"
/inference="alignment:Splign:2.1.0"
ORIGIN
atgggcgagcataatctctttaatccggggtttgttggacaattggttaacattaatgcaagagatgcattttacctctccaatttccgtgcgtcggggggacagctagcaggactgcaaaccctccgcttatccagaagagataatgtctgctctttgccttggaacccatcggaagcatgcagtggatacccacaatctcatattagcggccccgttaccctaaaccacacatacaatcaatcatgcgacattactcggcaggaagacaacaaatgtttttatagtgacagtgcatgcgccaccagcggcggtggtgacaataacagtaccaatcttatatcaaaagagggagcattggataactcatctgtatccattactgcagagaacggacagaacaatctgaacggaatggacaacggaggaagttattcaaaatatgactgcctgacacctgcagaacagcctatcccaaatcctcgtttgtgtcggtctcttgaatcggtttctggctgttcgttcataaacgagggggccaagacctcatcaggcatcacgcattcactaacatcccctgacatccaaacaagtgttgcagcactaaacggaggtgctctgtggtacccaatgcacagacaaactcgaaagaagcgtaaaccatattcaaaacttcagctgaacgagttggagggcgagttcatcctcaacgagttcatcaccagacagcggaggagggaactgtctgaccggctaaatctcacggaccaacaagtgaaaatctggttccaaaatcgtcgaatgaagaagaaaaggctcttgatgcgagagcaggctttatcttacttttag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]