2025-07-11 14:44:11, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_131544 948 bp mRNA linear VRT 07-DEC-2024 DEFINITION Danio rerio homeobox A11a (hoxa11a), mRNA. ACCESSION NM_131544 VERSION NM_131544.1 KEYWORDS RefSeq. SOURCE Danio rerio (zebrafish) ORGANISM Danio rerio Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Danionidae; Danioninae; Danio. REFERENCE 1 (bases 1 to 948) AUTHORS Sundaramoorthi,H., Fallatah,W., Mary,J. and Jagadeeswaran,P. TITLE Discovery of seven hox genes in zebrafish thrombopoiesis JOURNAL Blood Cells Mol Dis 104, 102796 (2024) PUBMED 37717409 REFERENCE 2 (bases 1 to 948) AUTHORS Banu,S., Gaur,N., Nair,S., Ravikrishnan,T., Khan,S., Mani,S., Bharathi,S., Mandal,K., Kuram,N.A., Vuppaladadium,S., Ravi,R., Murthy,C.L.N., Quoseena,M., Babu,N.S. and Idris,M.M. TITLE Understanding the complexity of epimorphic regeneration in zebrafish caudal fin tissue: A transcriptomic and proteomic approach JOURNAL Genomics 114 (2), 110300 (2022) PUBMED 35134499 REFERENCE 3 (bases 1 to 948) AUTHORS Yamada,K., Maeno,A., Araki,S., Kikuchi,M., Suzuki,M., Ishizaka,M., Satoh,K., Akama,K., Kawabe,Y., Suzuki,K., Kobayashi,D., Hamano,N. and Kawamura,A. TITLE An atlas of seven zebrafish hox cluster mutants provides insights into sub/neofunctionalization of vertebrate Hox clusters JOURNAL Development 148 (11) (2021) PUBMED 34096572 REFERENCE 4 (bases 1 to 948) AUTHORS Hawkins,M.B., Henke,K. and Harris,M.P. TITLE Latent developmental potential to form limb-like skeletal structures in zebrafish JOURNAL Cell 184 (4), 899-911 (2021) PUBMED 33545089 REFERENCE 5 (bases 1 to 948) AUTHORS Zuccarini,G., D'Atri,I., Cottone,E., Mackie,K., Shainer,I., Gothilf,Y., Provero,P., Bovolin,P. and Merlo,G.R. TITLE Interference with the Cannabinoid Receptor CB1R Results in Miswiring of GnRH3 and AgRP1 Axons in Zebrafish Embryos JOURNAL Int J Mol Sci 21 (1), 168 (2019) PUBMED 31881740 REMARK Publication Status: Online-Only REFERENCE 6 (bases 1 to 948) AUTHORS Santini,S. and Bernardi,G. TITLE Organization and base composition of tilapia Hox genes: implications for the evolution of Hox clusters in fish JOURNAL Gene 346, 51-61 (2005) PUBMED 15716008 REFERENCE 7 (bases 1 to 948) AUTHORS Chiu,C.H., Dewar,K., Wagner,G.P., Takahashi,K., Ruddle,F., Ledje,C., Bartsch,P., Scemama,J.L., Stellwag,E., Fried,C., Prohaska,S.J., Stadler,P.F. and Amemiya,C.T. TITLE Bichir HoxA cluster sequence reveals surprising trends in ray-finned fish genomic evolution JOURNAL Genome Res 14 (1), 11-17 (2004) PUBMED 14707166 REFERENCE 8 (bases 1 to 948) AUTHORS Amores,A., Suzuki,T., Yan,Y.L., Pomeroy,J., Singer,A., Amemiya,C. and Postlethwait,J.H. TITLE Developmental roles of pufferfish Hox clusters and genome evolution in ray-fin fish JOURNAL Genome Res 14 (1), 1-10 (2004) PUBMED 14707165 REFERENCE 9 (bases 1 to 948) AUTHORS Lavoie,H., Debeane,F., Trinh,Q.D., Turcotte,J.F., Corbeil-Girard,L.P., Dicaire,M.J., Saint-Denis,A., Page,M., Rouleau,G.A. and Brais,B. TITLE Polymorphism, shared functions and convergent evolution of genes with sequences coding for polyalanine domains JOURNAL Hum Mol Genet 12 (22), 2967-2979 (2003) PUBMED 14519685 REFERENCE 10 (bases 1 to 948) AUTHORS Chiu,C.H., Amemiya,C., Dewar,K., Kim,C.B., Ruddle,F.H. and Wagner,G.P. TITLE Molecular evolution of the HoxA cluster in the three major gnathostome lineages JOURNAL Proc Natl Acad Sci U S A 99 (8), 5492-5497 (2002) PUBMED 11943847 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AF071240.1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. FEATURES Location/Qualifiers source 1..948 /organism="Danio rerio" /mol_type="mRNA" /db_xref="taxon:7955" /chromosome="19" /map="19" gene 1..948 /gene="hoxa11a" /gene_synonym="sb:eu415" /note="homeobox A11a" /db_xref="GeneID:58061" /db_xref="ZFIN:ZDB-GENE-000823-8" CDS 1..948 /gene="hoxa11a" /gene_synonym="sb:eu415" /note="homeo box A11a" /codon_start=1 /product="homeobox protein Hox-A11a" /protein_id="NP_571619.1" /db_xref="GeneID:58061" /db_xref="ZFIN:ZDB-GENE-000823-8" /translation="
MMDFDERVSVGSNMYLPSCTYYVPGADFSTLPSFLSQSPSTRPVTYSYASNLPQVQHVREVTFRDYAIDPSTKWPHRGPLAHCYPSEDSVHKECLPAVTTVGEMFPKNNASAYYHSTSNTTSASNFYGNVGRNGVLPQAFDQFFDTAYGGSDSVVDNDYAARDKMHSSKQSTPAPAPEQQPEGKERPETSSPESSSGNNEEKTSGANSKYELNKTVMRESLQCCALLLKFYMLFYKRIGGPRFRKKRCPYTKFQIRELEREFFFSVYINKEKRLQLSRMLNLTDRQVKMWFQNRRMKEKKLNRDRLQYYSTNPLL"
misc_feature 76..459 /gene="hoxa11a" /gene_synonym="sb:eu415" /note="Protein of unknown function (DUF3528); Region: DUF3528; pfam12045" /db_xref="CDD:432284" misc_feature 730..900 /gene="hoxa11a" /gene_synonym="sb:eu415" /note="Region: Homeodomain; pfam00046" /db_xref="CDD:459649" exon 1..712 /gene="hoxa11a" /gene_synonym="sb:eu415" /inference="alignment:Splign:2.1.0" exon 713..948 /gene="hoxa11a" /gene_synonym="sb:eu415" /inference="alignment:Splign:2.1.0" ORIGIN
atgatggattttgacgaaagggtttccgttggctccaacatgtatctgcccagctgcacatattacgttccgggggctgatttttccacgttgccctcttttctatcccaaagcccgtctactcgcccagtcacttactcttacgcttccaacctgcctcaggtacagcatgtcagggaggttacattccgggactatgctattgacccgtccaccaaatggcctcaccggggtccactggcacattgttatccgtcggaggattcagtccacaaggagtgtttaccagctgtaacgactgttggagaaatgttccctaagaataatgcatctgcgtattatcattctacatcgaacacgacatctgcgtccaatttttacggcaacgttggaagaaacggtgtgcttcctcaagcatttgaccagttttttgacaccgcctacggaggctcggacagtgtagtagacaacgactatgcagcaagggataaaatgcactccagcaaacagtcgacaccagcgcccgcaccggagcagcagcccgaaggaaaggagcgaccggagaccagtagccccgaatcatcttccggaaacaatgaggaaaaaactagcggtgcgaacagtaagtacgagctcaacaagactgtcatgcgagagagtttgcaatgttgcgcgctcctgttaaaattttatatgctgttttataagcgtataggtgggcccaggtttcgtaagaagaggtgtccctacactaaatttcaaattcgggagcttgaaagggaattcttcttcagcgtgtacatcaacaaagaaaaacgacttcagctctcacggatgcttaacctcactgatcgccaagtgaaaatgtggttccagaaccggcgcatgaaggaaaaaaaactaaatcgggacaggttacagtattacagtaccaatccactgctatag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]