LOCUS       NM_131544                948 bp    mRNA    linear   VRT 03-APR-2024
DEFINITION  Danio rerio homeobox A11a (hoxa11a), mRNA.
ACCESSION   NM_131544
VERSION     NM_131544.1
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 948)
  AUTHORS   Banu,S., Gaur,N., Nair,S., Ravikrishnan,T., Khan,S., Mani,S.,
            Bharathi,S., Mandal,K., Kuram,N.A., Vuppaladadium,S., Ravi,R.,
            Murthy,C.L.N., Quoseena,M., Babu,N.S. and Idris,M.M.
  TITLE     Understanding the complexity of epimorphic regeneration in
            zebrafish caudal fin tissue: A transcriptomic and proteomic
            approach
  JOURNAL   Genomics 114 (2), 110300 (2022)
   PUBMED   35134499
REFERENCE   2  (bases 1 to 948)
  AUTHORS   Yamada,K., Maeno,A., Araki,S., Kikuchi,M., Suzuki,M., Ishizaka,M.,
            Satoh,K., Akama,K., Kawabe,Y., Suzuki,K., Kobayashi,D., Hamano,N.
            and Kawamura,A.
  TITLE     An atlas of seven zebrafish hox cluster mutants provides insights
            into sub/neofunctionalization of vertebrate Hox clusters
  JOURNAL   Development 148 (11) (2021)
   PUBMED   34096572
REFERENCE   3  (bases 1 to 948)
  AUTHORS   Hawkins,M.B., Henke,K. and Harris,M.P.
  TITLE     Latent developmental potential to form limb-like skeletal
            structures in zebrafish
  JOURNAL   Cell 184 (4), 899-911 (2021)
   PUBMED   33545089
REFERENCE   4  (bases 1 to 948)
  AUTHORS   Zuccarini,G., D'Atri,I., Cottone,E., Mackie,K., Shainer,I.,
            Gothilf,Y., Provero,P., Bovolin,P. and Merlo,G.R.
  TITLE     Interference with the Cannabinoid Receptor CB1R Results in
            Miswiring of GnRH3 and AgRP1 Axons in Zebrafish Embryos
  JOURNAL   Int J Mol Sci 21 (1), 168 (2019)
   PUBMED   31881740
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 948)
  AUTHORS   Langellotto,F., Fiorentino,M., De Felice,E., Caputi,L., Nittoli,V.,
            Joss,J.M.P. and Sordino,P.
  TITLE     Expression of meis and hoxa11 in dipnoan and teleost fins provides
            new insights into the evolution of vertebrate appendages
  JOURNAL   Evodevo 9, 11 (2018)
   PUBMED   29719716
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 948)
  AUTHORS   Santini,S. and Bernardi,G.
  TITLE     Organization and base composition of tilapia Hox genes:
            implications for the evolution of Hox clusters in fish
  JOURNAL   Gene 346, 51-61 (2005)
   PUBMED   15716008
REFERENCE   7  (bases 1 to 948)
  AUTHORS   Chiu,C.H., Dewar,K., Wagner,G.P., Takahashi,K., Ruddle,F.,
            Ledje,C., Bartsch,P., Scemama,J.L., Stellwag,E., Fried,C.,
            Prohaska,S.J., Stadler,P.F. and Amemiya,C.T.
  TITLE     Bichir HoxA cluster sequence reveals surprising trends in
            ray-finned fish genomic evolution
  JOURNAL   Genome Res 14 (1), 11-17 (2004)
   PUBMED   14707166
REFERENCE   8  (bases 1 to 948)
  AUTHORS   Amores,A., Suzuki,T., Yan,Y.L., Pomeroy,J., Singer,A., Amemiya,C.
            and Postlethwait,J.H.
  TITLE     Developmental roles of pufferfish Hox clusters and genome evolution
            in ray-fin fish
  JOURNAL   Genome Res 14 (1), 1-10 (2004)
   PUBMED   14707165
REFERENCE   9  (bases 1 to 948)
  AUTHORS   Lavoie,H., Debeane,F., Trinh,Q.D., Turcotte,J.F.,
            Corbeil-Girard,L.P., Dicaire,M.J., Saint-Denis,A., Page,M.,
            Rouleau,G.A. and Brais,B.
  TITLE     Polymorphism, shared functions and convergent evolution of genes
            with sequences coding for polyalanine domains
  JOURNAL   Hum Mol Genet 12 (22), 2967-2979 (2003)
   PUBMED   14519685
REFERENCE   10 (bases 1 to 948)
  AUTHORS   Chiu,C.H., Amemiya,C., Dewar,K., Kim,C.B., Ruddle,F.H. and
            Wagner,G.P.
  TITLE     Molecular evolution of the HoxA cluster in the three major
            gnathostome lineages
  JOURNAL   Proc Natl Acad Sci U S A 99 (8), 5492-5497 (2002)
   PUBMED   11943847
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AF071240.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
FEATURES             Location/Qualifiers
     source          1..948
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /db_xref="taxon:7955"
                     /chromosome="19"
                     /map="19"
     gene            1..948
                     /gene="hoxa11a"
                     /gene_synonym="sb:eu415"
                     /note="homeobox A11a"
                     /db_xref="GeneID:58061"
                     /db_xref="ZFIN:ZDB-GENE-000823-8"
     CDS             1..948
                     /gene="hoxa11a"
                     /gene_synonym="sb:eu415"
                     /note="homeo box A11a"
                     /codon_start=1
                     /product="homeobox protein Hox-A11a"
                     /protein_id="NP_571619.1"
                     /db_xref="GeneID:58061"
                     /db_xref="ZFIN:ZDB-GENE-000823-8"
                     /translation="

MMDFDERVSVGSNMYLPSCTYYVPGADFSTLPSFLSQSPSTRPVTYSYASNLPQVQHVREVTFRDYAIDPSTKWPHRGPLAHCYPSEDSVHKECLPAVTTVGEMFPKNNASAYYHSTSNTTSASNFYGNVGRNGVLPQAFDQFFDTAYGGSDSVVDNDYAARDKMHSSKQSTPAPAPEQQPEGKERPETSSPESSSGNNEEKTSGANSKYELNKTVMRESLQCCALLLKFYMLFYKRIGGPRFRKKRCPYTKFQIRELEREFFFSVYINKEKRLQLSRMLNLTDRQVKMWFQNRRMKEKKLNRDRLQYYSTNPLL"

     misc_feature    76..459
                     /gene="hoxa11a"
                     /gene_synonym="sb:eu415"
                     /note="Protein of unknown function (DUF3528); Region:
                     DUF3528; pfam12045"
                     /db_xref="CDD:432284"
     misc_feature    730..900
                     /gene="hoxa11a"
                     /gene_synonym="sb:eu415"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     exon            1..712
                     /gene="hoxa11a"
                     /gene_synonym="sb:eu415"
                     /inference="alignment:Splign:2.1.0"
     exon            713..948
                     /gene="hoxa11a"
                     /gene_synonym="sb:eu415"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

atgatggattttgacgaaagggtttccgttggctccaacatgtatctgcccagctgcacatattacgttccgggggctgatttttccacgttgccctcttttctatcccaaagcccgtctactcgcccagtcacttactcttacgcttccaacctgcctcaggtacagcatgtcagggaggttacattccgggactatgctattgacccgtccaccaaatggcctcaccggggtccactggcacattgttatccgtcggaggattcagtccacaaggagtgtttaccagctgtaacgactgttggagaaatgttccctaagaataatgcatctgcgtattatcattctacatcgaacacgacatctgcgtccaatttttacggcaacgttggaagaaacggtgtgcttcctcaagcatttgaccagttttttgacaccgcctacggaggctcggacagtgtagtagacaacgactatgcagcaagggataaaatgcactccagcaaacagtcgacaccagcgcccgcaccggagcagcagcccgaaggaaaggagcgaccggagaccagtagccccgaatcatcttccggaaacaatgaggaaaaaactagcggtgcgaacagtaagtacgagctcaacaagactgtcatgcgagagagtttgcaatgttgcgcgctcctgttaaaattttatatgctgttttataagcgtataggtgggcccaggtttcgtaagaagaggtgtccctacactaaatttcaaattcgggagcttgaaagggaattcttcttcagcgtgtacatcaacaaagaaaaacgacttcagctctcacggatgcttaacctcactgatcgccaagtgaaaatgtggttccagaaccggcgcatgaaggaaaaaaaactaaatcgggacaggttacagtattacagtaccaatccactgctatag

//