GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-10-31 21:23:33, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       NM_131147                852 bp    mRNA    linear   VRT 23-MAR-2025
DEFINITION  Danio rerio homeobox A11b (hoxa11b), mRNA.
ACCESSION   NM_131147
VERSION     NM_131147.1
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 852)
  AUTHORS   Ishizaka,M., Maeno,A., Nakazawa,H., Fujii,R., Oikawa,S., Tani,T.,
            Kanno,H., Koita,R. and Kawamura,A.
  TITLE     The functional roles of zebrafish HoxA- and HoxD-related clusters
            in the pectoral fin development
  JOURNAL   Sci Rep 14 (1), 23602 (2024)
   PUBMED   39384796
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 852)
  AUTHORS   Sundaramoorthi,H., Fallatah,W., Mary,J. and Jagadeeswaran,P.
  TITLE     Discovery of seven hox genes in zebrafish thrombopoiesis
  JOURNAL   Blood Cells Mol Dis 104, 102796 (2024)
   PUBMED   37717409
REFERENCE   3  (bases 1 to 852)
  AUTHORS   Yamada,K., Maeno,A., Araki,S., Kikuchi,M., Suzuki,M., Ishizaka,M.,
            Satoh,K., Akama,K., Kawabe,Y., Suzuki,K., Kobayashi,D., Hamano,N.
            and Kawamura,A.
  TITLE     An atlas of seven zebrafish hox cluster mutants provides insights
            into sub/neofunctionalization of vertebrate Hox clusters
  JOURNAL   Development 148 (11) (2021)
   PUBMED   34096572
REFERENCE   4  (bases 1 to 852)
  AUTHORS   Hawkins,M.B., Henke,K. and Harris,M.P.
  TITLE     Latent developmental potential to form limb-like skeletal
            structures in zebrafish
  JOURNAL   Cell 184 (4), 899-911 (2021)
   PUBMED   33545089
REFERENCE   5  (bases 1 to 852)
  AUTHORS   Smeeton,J., Natarajan,N., Naveen Kumar,A., Miyashita,T., Baddam,P.,
            Fabian,P., Graf,D. and Crump,J.G.
  TITLE     Zebrafish model for spondylo-megaepiphyseal-metaphyseal dysplasia
            reveals post-embryonic roles of Nkx3.2 in the skeleton
  JOURNAL   Development 148 (2) (2021)
   PUBMED   33462117
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 852)
  AUTHORS   Chiu,C.H., Dewar,K., Wagner,G.P., Takahashi,K., Ruddle,F.,
            Ledje,C., Bartsch,P., Scemama,J.L., Stellwag,E., Fried,C.,
            Prohaska,S.J., Stadler,P.F. and Amemiya,C.T.
  TITLE     Bichir HoxA cluster sequence reveals surprising trends in
            ray-finned fish genomic evolution
  JOURNAL   Genome Res 14 (1), 11-17 (2004)
   PUBMED   14707166
REFERENCE   7  (bases 1 to 852)
  AUTHORS   Amores,A., Suzuki,T., Yan,Y.L., Pomeroy,J., Singer,A., Amemiya,C.
            and Postlethwait,J.H.
  TITLE     Developmental roles of pufferfish Hox clusters and genome evolution
            in ray-fin fish
  JOURNAL   Genome Res 14 (1), 1-10 (2004)
   PUBMED   14707165
REFERENCE   8  (bases 1 to 852)
  AUTHORS   Lavoie,H., Debeane,F., Trinh,Q.D., Turcotte,J.F.,
            Corbeil-Girard,L.P., Dicaire,M.J., Saint-Denis,A., Page,M.,
            Rouleau,G.A. and Brais,B.
  TITLE     Polymorphism, shared functions and convergent evolution of genes
            with sequences coding for polyalanine domains
  JOURNAL   Hum Mol Genet 12 (22), 2967-2979 (2003)
   PUBMED   14519685
REFERENCE   9  (bases 1 to 852)
  AUTHORS   Chiu,C.H., Amemiya,C., Dewar,K., Kim,C.B., Ruddle,F.H. and
            Wagner,G.P.
  TITLE     Molecular evolution of the HoxA cluster in the three major
            gnathostome lineages
  JOURNAL   Proc Natl Acad Sci U S A 99 (8), 5492-5497 (2002)
   PUBMED   11943847
REFERENCE   10 (bases 1 to 852)
  AUTHORS   Chiu,C.H., Amemiya,C.T., Carr,J.L., Bhargava,J., Hwang,J.K.,
            Shashikant,C.S., Ruddle,F.H. and Wagner,G.P.
  TITLE     A recombinogenic targeting method to modify large-inserts for
            cis-regulatory analysis in transgenic mice: construction and
            expression of a 100-kb, zebrafish Hoxa-11b-lacZ reporter gene
  JOURNAL   Dev Genes Evol 210 (2), 105-109 (2000)
   PUBMED   10664153
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AF287137.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC162917.1, EH582303.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA3505370, SAMEA3505371
                                           [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..852
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /db_xref="taxon:7955"
                     /chromosome="16"
                     /map="16"
     gene            1..852
                     /gene="hoxa11b"
                     /gene_synonym="Hoxa-11; hoxa11; im:7142641"
                     /note="homeobox A11b"
                     /db_xref="GeneID:30382"
                     /db_xref="ZFIN:ZDB-GENE-990415-4"
     CDS             1..852
                     /gene="hoxa11b"
                     /gene_synonym="Hoxa-11; hoxa11; im:7142641"
                     /note="hox-A11; homeobox gene A-11; homeo box A11b"
                     /codon_start=1
                     /product="homeobox protein Hox-A11b"
                     /protein_id="NP_571222.1"
                     /db_xref="GeneID:30382"
                     /db_xref="ZFIN:ZDB-GENE-990415-4"
                     /translation="
MMDFDERVPVGSNMYLPGCTYYVSGTDFSSLPPFLPQTPSSCPMTYSYSTSSLPQVQSVREVSFRDYAIDTSSKWHSRGNLPHCYATEDMVHRECLSNPGTLGDMLSKNNSVLYHSNSSHTSNVYGSVGRNGVLPQAFDQFFETAYGNVENQPTEHPVDRATSKAPPPAESGSDSCRGTDETERCEETSSPEPSSGNNEDKFSGSSNGQKTRKKRCPYTKYQIRELEREFFFSVYINKEKRLQLSRMLNLTDRQVKIWFQNRRMKEKKLNRDRLQYYTTNPLL"
     misc_feature    76..453
                     /gene="hoxa11b"
                     /gene_synonym="Hoxa-11; hoxa11; im:7142641"
                     /note="Protein of unknown function (DUF3528); Region:
                     DUF3528; pfam12045"
                     /db_xref="CDD:432284"
     misc_feature    448..645
                     /gene="hoxa11b"
                     /gene_synonym="Hoxa-11; hoxa11; im:7142641"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9DDU1.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    634..804
                     /gene="hoxa11b"
                     /gene_synonym="Hoxa-11; hoxa11; im:7142641"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     exon            1..619
                     /gene="hoxa11b"
                     /gene_synonym="Hoxa-11; hoxa11; im:7142641"
                     /inference="alignment:Splign:2.1.0"
     exon            620..852
                     /gene="hoxa11b"
                     /gene_synonym="Hoxa-11; hoxa11; im:7142641"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
atgatggattttgatgagcgggtacccgttgggtccaacatgtatttgcccggctgtacttattacgtgtctggaacggacttttccagccttcctccttttctgccccagaccccgtcttcttgccccatgacatactcatactccacgtccagtttgccacaagttcagagcgtaagagaggtatctttcagggactatgctattgacacgtccagtaagtggcactccagggggaatctgccacactgctacgcgaccgaagacatggtgcacagggagtgcctgtccaatccagggactttgggagacatgctatcgaaaaataactcggttctctaccactccaactcgagccacacgtccaacgtgtacggcagcgtggggaggaacggagtgcttcctcaagcctttgaccagtttttcgagacagcatacgggaacgtggaaaatcagccgactgagcatccggtggacagagcaaccagcaaggcgcctccacccgcagaatcgggcagcgacagttgtcggggaacagatgagaccgagcggtgtgaagagacaagcagcccggagccatcttccggcaacaacgaagataaattcagcggcagcagcaatggacaaaagacacggaaaaaaaggtgcccttacacgaaatatcagattagagagctggagagagaatttttcttcagtgtttacatcaacaaagaaaaaaggctacagctttccagaatgctcaacctcactgaccgtcaggtcaaaatatggtttcaaaacagaaggatgaaagaaaaaaaattgaatagagaccgtctgcagtattataccacgaaccctttgctttag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]