ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-29 04:01:34, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NM_131147 852 bp mRNA linear VRT 23-MAR-2025 DEFINITION Danio rerio homeobox A11b (hoxa11b), mRNA. ACCESSION NM_131147 VERSION NM_131147.1 KEYWORDS RefSeq. SOURCE Danio rerio (zebrafish) ORGANISM Danio rerio Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Danionidae; Danioninae; Danio. REFERENCE 1 (bases 1 to 852) AUTHORS Ishizaka,M., Maeno,A., Nakazawa,H., Fujii,R., Oikawa,S., Tani,T., Kanno,H., Koita,R. and Kawamura,A. TITLE The functional roles of zebrafish HoxA- and HoxD-related clusters in the pectoral fin development JOURNAL Sci Rep 14 (1), 23602 (2024) PUBMED 39384796 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 852) AUTHORS Sundaramoorthi,H., Fallatah,W., Mary,J. and Jagadeeswaran,P. TITLE Discovery of seven hox genes in zebrafish thrombopoiesis JOURNAL Blood Cells Mol Dis 104, 102796 (2024) PUBMED 37717409 REFERENCE 3 (bases 1 to 852) AUTHORS Yamada,K., Maeno,A., Araki,S., Kikuchi,M., Suzuki,M., Ishizaka,M., Satoh,K., Akama,K., Kawabe,Y., Suzuki,K., Kobayashi,D., Hamano,N. and Kawamura,A. TITLE An atlas of seven zebrafish hox cluster mutants provides insights into sub/neofunctionalization of vertebrate Hox clusters JOURNAL Development 148 (11) (2021) PUBMED 34096572 REFERENCE 4 (bases 1 to 852) AUTHORS Hawkins,M.B., Henke,K. and Harris,M.P. TITLE Latent developmental potential to form limb-like skeletal structures in zebrafish JOURNAL Cell 184 (4), 899-911 (2021) PUBMED 33545089 REFERENCE 5 (bases 1 to 852) AUTHORS Smeeton,J., Natarajan,N., Naveen Kumar,A., Miyashita,T., Baddam,P., Fabian,P., Graf,D. and Crump,J.G. TITLE Zebrafish model for spondylo-megaepiphyseal-metaphyseal dysplasia reveals post-embryonic roles of Nkx3.2 in the skeleton JOURNAL Development 148 (2) (2021) PUBMED 33462117 REMARK Publication Status: Online-Only REFERENCE 6 (bases 1 to 852) AUTHORS Chiu,C.H., Dewar,K., Wagner,G.P., Takahashi,K., Ruddle,F., Ledje,C., Bartsch,P., Scemama,J.L., Stellwag,E., Fried,C., Prohaska,S.J., Stadler,P.F. and Amemiya,C.T. TITLE Bichir HoxA cluster sequence reveals surprising trends in ray-finned fish genomic evolution JOURNAL Genome Res 14 (1), 11-17 (2004) PUBMED 14707166 REFERENCE 7 (bases 1 to 852) AUTHORS Amores,A., Suzuki,T., Yan,Y.L., Pomeroy,J., Singer,A., Amemiya,C. and Postlethwait,J.H. TITLE Developmental roles of pufferfish Hox clusters and genome evolution in ray-fin fish JOURNAL Genome Res 14 (1), 1-10 (2004) PUBMED 14707165 REFERENCE 8 (bases 1 to 852) AUTHORS Lavoie,H., Debeane,F., Trinh,Q.D., Turcotte,J.F., Corbeil-Girard,L.P., Dicaire,M.J., Saint-Denis,A., Page,M., Rouleau,G.A. and Brais,B. TITLE Polymorphism, shared functions and convergent evolution of genes with sequences coding for polyalanine domains JOURNAL Hum Mol Genet 12 (22), 2967-2979 (2003) PUBMED 14519685 REFERENCE 9 (bases 1 to 852) AUTHORS Chiu,C.H., Amemiya,C., Dewar,K., Kim,C.B., Ruddle,F.H. and Wagner,G.P. TITLE Molecular evolution of the HoxA cluster in the three major gnathostome lineages JOURNAL Proc Natl Acad Sci U S A 99 (8), 5492-5497 (2002) PUBMED 11943847 REFERENCE 10 (bases 1 to 852) AUTHORS Chiu,C.H., Amemiya,C.T., Carr,J.L., Bhargava,J., Hwang,J.K., Shashikant,C.S., Ruddle,F.H. and Wagner,G.P. TITLE A recombinogenic targeting method to modify large-inserts for cis-regulatory analysis in transgenic mice: construction and expression of a 100-kb, zebrafish Hoxa-11b-lacZ reporter gene JOURNAL Dev Genes Evol 210 (2), 105-109 (2000) PUBMED 10664153 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AF287137.1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC162917.1, EH582303.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA3505370, SAMEA3505371 [ECO:0000348] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..852 /organism="Danio rerio" /mol_type="mRNA" /db_xref="taxon:7955" /chromosome="16" /map="16" gene 1..852 /gene="hoxa11b" /gene_synonym="Hoxa-11; hoxa11; im:7142641" /note="homeobox A11b" /db_xref="GeneID:30382" /db_xref="ZFIN:ZDB-GENE-990415-4" CDS 1..852 /gene="hoxa11b" /gene_synonym="Hoxa-11; hoxa11; im:7142641" /note="hox-A11; homeobox gene A-11; homeo box A11b" /codon_start=1 /product="homeobox protein Hox-A11b" /protein_id="NP_571222.1" /db_xref="GeneID:30382" /db_xref="ZFIN:ZDB-GENE-990415-4" /translation="
MMDFDERVPVGSNMYLPGCTYYVSGTDFSSLPPFLPQTPSSCPMTYSYSTSSLPQVQSVREVSFRDYAIDTSSKWHSRGNLPHCYATEDMVHRECLSNPGTLGDMLSKNNSVLYHSNSSHTSNVYGSVGRNGVLPQAFDQFFETAYGNVENQPTEHPVDRATSKAPPPAESGSDSCRGTDETERCEETSSPEPSSGNNEDKFSGSSNGQKTRKKRCPYTKYQIRELEREFFFSVYINKEKRLQLSRMLNLTDRQVKIWFQNRRMKEKKLNRDRLQYYTTNPLL"
misc_feature 76..453
/gene="hoxa11b"
/gene_synonym="Hoxa-11; hoxa11; im:7142641"
/note="Protein of unknown function (DUF3528); Region:
DUF3528; pfam12045"
/db_xref="CDD:432284"
misc_feature 448..645
/gene="hoxa11b"
/gene_synonym="Hoxa-11; hoxa11; im:7142641"
/note="propagated from UniProtKB/Swiss-Prot (Q9DDU1.1);
Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
misc_feature 634..804
/gene="hoxa11b"
/gene_synonym="Hoxa-11; hoxa11; im:7142641"
/note="Region: Homeodomain; pfam00046"
/db_xref="CDD:459649"
exon 1..619
/gene="hoxa11b"
/gene_synonym="Hoxa-11; hoxa11; im:7142641"
/inference="alignment:Splign:2.1.0"
exon 620..852
/gene="hoxa11b"
/gene_synonym="Hoxa-11; hoxa11; im:7142641"
/inference="alignment:Splign:2.1.0"
ORIGIN
atgatggattttgatgagcgggtacccgttgggtccaacatgtatttgcccggctgtacttattacgtgtctggaacggacttttccagccttcctccttttctgccccagaccccgtcttcttgccccatgacatactcatactccacgtccagtttgccacaagttcagagcgtaagagaggtatctttcagggactatgctattgacacgtccagtaagtggcactccagggggaatctgccacactgctacgcgaccgaagacatggtgcacagggagtgcctgtccaatccagggactttgggagacatgctatcgaaaaataactcggttctctaccactccaactcgagccacacgtccaacgtgtacggcagcgtggggaggaacggagtgcttcctcaagcctttgaccagtttttcgagacagcatacgggaacgtggaaaatcagccgactgagcatccggtggacagagcaaccagcaaggcgcctccacccgcagaatcgggcagcgacagttgtcggggaacagatgagaccgagcggtgtgaagagacaagcagcccggagccatcttccggcaacaacgaagataaattcagcggcagcagcaatggacaaaagacacggaaaaaaaggtgcccttacacgaaatatcagattagagagctggagagagaatttttcttcagtgtttacatcaacaaagaaaaaaggctacagctttccagaatgctcaacctcactgaccgtcaggtcaaaatatggtttcaaaacagaaggatgaaagaaaaaaaattgaatagagaccgtctgcagtattataccacgaaccctttgctttag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]