GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-11-02 20:17:53, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       NM_131106               1797 bp    mRNA    linear   VRT 23-MAR-2025
DEFINITION  Danio rerio homeobox A2b (hoxa2b), mRNA.
ACCESSION   NM_131106
VERSION     NM_131106.1
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 1797)
  AUTHORS   Ishizaka,M., Maeno,A., Nakazawa,H., Fujii,R., Oikawa,S., Tani,T.,
            Kanno,H., Koita,R. and Kawamura,A.
  TITLE     The functional roles of zebrafish HoxA- and HoxD-related clusters
            in the pectoral fin development
  JOURNAL   Sci Rep 14 (1), 23602 (2024)
   PUBMED   39384796
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1797)
  AUTHORS   Sundaramoorthi,H., Fallatah,W., Mary,J. and Jagadeeswaran,P.
  TITLE     Discovery of seven hox genes in zebrafish thrombopoiesis
  JOURNAL   Blood Cells Mol Dis 104, 102796 (2024)
   PUBMED   37717409
REFERENCE   3  (bases 1 to 1797)
  AUTHORS   Banu,S., Gaur,N., Nair,S., Ravikrishnan,T., Khan,S., Mani,S.,
            Bharathi,S., Mandal,K., Kuram,N.A., Vuppaladadium,S., Ravi,R.,
            Murthy,C.L.N., Quoseena,M., Babu,N.S. and Idris,M.M.
  TITLE     Understanding the complexity of epimorphic regeneration in
            zebrafish caudal fin tissue: A transcriptomic and proteomic
            approach
  JOURNAL   Genomics 114 (2), 110300 (2022)
   PUBMED   35134499
REFERENCE   4  (bases 1 to 1797)
  AUTHORS   Mukaigasa,K., Sakuma,C. and Yaginuma,H.
  TITLE     The developmental hourglass model is applicable to the spinal cord
            based on single-cell transcriptomes and non-conserved
            cis-regulatory elements
  JOURNAL   Dev Growth Differ 63 (7), 372-391 (2021)
   PUBMED   34473348
REFERENCE   5  (bases 1 to 1797)
  AUTHORS   Yamada,K., Maeno,A., Araki,S., Kikuchi,M., Suzuki,M., Ishizaka,M.,
            Satoh,K., Akama,K., Kawabe,Y., Suzuki,K., Kobayashi,D., Hamano,N.
            and Kawamura,A.
  TITLE     An atlas of seven zebrafish hox cluster mutants provides insights
            into sub/neofunctionalization of vertebrate Hox clusters
  JOURNAL   Development 148 (11) (2021)
   PUBMED   34096572
REFERENCE   6  (bases 1 to 1797)
  AUTHORS   Hunter,M.P. and Prince,V.E.
  TITLE     Zebrafish hox paralogue group 2 genes function redundantly as
            selector genes to pattern the second pharyngeal arch
  JOURNAL   Dev Biol 247 (2), 367-389 (2002)
   PUBMED   12086473
REFERENCE   7  (bases 1 to 1797)
  AUTHORS   Moens,C.B. and Prince,V.E.
  TITLE     Constructing the hindbrain: insights from the zebrafish
  JOURNAL   Dev Dyn 224 (1), 1-17 (2002)
   PUBMED   11984869
  REMARK    Review article
REFERENCE   8  (bases 1 to 1797)
  AUTHORS   Chiu,C.H., Amemiya,C., Dewar,K., Kim,C.B., Ruddle,F.H. and
            Wagner,G.P.
  TITLE     Molecular evolution of the HoxA cluster in the three major
            gnathostome lineages
  JOURNAL   Proc Natl Acad Sci U S A 99 (8), 5492-5497 (2002)
   PUBMED   11943847
REFERENCE   9  (bases 1 to 1797)
  AUTHORS   Pasqualetti,M., Ori,M., Nardi,I. and Rijli,F.M.
  TITLE     Ectopic Hoxa2 induction after neural crest migration results in
            homeosis of jaw elements in Xenopus
  JOURNAL   Development 127 (24), 5367-5378 (2000)
   PUBMED   11076758
REFERENCE   10 (bases 1 to 1797)
  AUTHORS   Weidinger,G., Wolke,U., Koprunner,M., Klinger,M. and Raz,E.
  TITLE     Identification of tissues and patterning events required for
            distinct steps in early migration of zebrafish primordial germ
            cells
  JOURNAL   Development 126 (23), 5295-5307 (1999)
   PUBMED   10556055
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AF307010.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF307010.1, BC162328.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA3505370, SAMEA3505372
                                           [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1797
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /db_xref="taxon:7955"
                     /chromosome="16"
                     /map="16"
     gene            1..1797
                     /gene="hoxa2b"
                     /gene_synonym="hoxa2; Z-75"
                     /note="homeobox A2b"
                     /db_xref="GeneID:30325"
                     /db_xref="ZFIN:ZDB-GENE-990415-98"
     exon            1..812
                     /gene="hoxa2b"
                     /gene_synonym="hoxa2; Z-75"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    407..409
                     /gene="hoxa2b"
                     /gene_synonym="hoxa2; Z-75"
                     /note="upstream in-frame stop codon"
     CDS             452..1543
                     /gene="hoxa2b"
                     /gene_synonym="hoxa2; Z-75"
                     /note="hox-A2; etID309949.16; homeobox gene A-2; homeo box
                     A2b"
                     /codon_start=1
                     /product="homeobox protein Hox-A2b"
                     /protein_id="NP_571181.1"
                     /db_xref="GeneID:30325"
                     /db_xref="ZFIN:ZDB-GENE-990415-98"
                     /translation="
MNYEFERETGFINSQPSLAECLTSFPPVGDAFQSSSIKSSTLSHSTLIPPPFEQTIPSLNPGSHPRHSRPKQNPNGSCPLPAASLPPEYPWMKEKKASKKNQTTSTAATTDPGPLYFSPQGSPEISDGGSGATRRLRTAYTNTQLLELEKEFHFNKYLCRPRRVEIAALLDLTERQVKVWFQNRRMKHKRQTQCKENHHGDGKPPSLEEAGGRGDGKSFFEQVANNVSGALLEREGYPFQQNTLTSQQSQNGHNSDSQSATVSPLGSNDKHLKHFPNPSPTVPICTTTMAPDCASAQDNGSPSALDVSLQDFNVFSNDSCLHLSDAVSPSLSESVDSPIGLTTEAFDFFSETLTTIDLQHLSY"
     misc_feature    575..847
                     /gene="hoxa2b"
                     /gene_synonym="hoxa2; Z-75"
                     /note="propagated from UniProtKB/Swiss-Prot (O42365.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    713..730
                     /gene="hoxa2b"
                     /gene_synonym="hoxa2; Z-75"
                     /note="propagated from UniProtKB/Swiss-Prot (O42365.2);
                     Region: Antp-type hexapeptide"
     misc_feature    851..1021
                     /gene="hoxa2b"
                     /gene_synonym="hoxa2; Z-75"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     misc_feature    1007..1105
                     /gene="hoxa2b"
                     /gene_synonym="hoxa2; Z-75"
                     /note="propagated from UniProtKB/Swiss-Prot (O42365.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    1184..1288
                     /gene="hoxa2b"
                     /gene_synonym="hoxa2; Z-75"
                     /note="propagated from UniProtKB/Swiss-Prot (O42365.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     exon            813..1797
                     /gene="hoxa2b"
                     /gene_synonym="hoxa2; Z-75"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gttttatgtgaacagttgatgtgttgtgggatctcctgccgaggaccgttaaatatgaagaaaacagcagacggactcactgtcactcttttcaggtactggctatacatgtaatctacggagcgagcagcgggcaaactgaccataaatgcgtaaataaactagcccgtcccagagagtgaggcgttcctctcggacttttttcgatcaatcacacagacagtggcttcttttgattaaaccccaaattgtcattggacagaggtaatcatgtgacaagcaatacggtccaatttcaaccttgtctccatgaaagcaatagtttaatggcaccgcggtccccatacggccgtaatcagcaaaatagttttttttaacccggcacgatatttcattatatcttccttgagtcacaaatttgagagcggcgaatttgcaagacttggaggagatgaattacgaattcgagcgagagacgggttttatcaatagtcagccgtcgctcgctgagtgcctgacatcttttccccctgtcggtgatgcatttcaaagttcatcaatcaagagctcgacgctttcacactcgacactgattcctcctccttttgagcagaccattccaagcctgaaccccggcagccaccctcgccacagccggcccaagcagaaccctaatggctcatgcccgctgcctgccgcatccttacccccagagtacccttggatgaaggagaaaaaagcatccaagaaaaaccagacaacttcgacagcggcaaccaccgaccctggtccactatacttctcccctcaaggctcgcccgagatttctgatggtggcagtggggcaactcgccgactcagaacggcgtacactaatactcagctgctggagctggagaaggagtttcacttcaacaagtatctgtgccggccaaggcgtgtggaaatcgccgctctgctagacctcactgaacgacaagtcaaagtttggtttcaaaaccggagaatgaaacacaaacggcaaacgcagtgcaaagagaatcatcacggcgatggaaaaccaccgagcctggaggaggcaggcggacggggtgatgggaaatcttttttcgaacaagtggcaaacaatgtatcaggggcgcttttggaaagagagggttatccatttcagcagaataccttaacttctcaacagtcacagaatggacacaatagtgattcccaaagcgcaactgtctcgcctttaggtagcaatgacaaacatctgaaacattttcccaacccgtcacccactgttcctatctgcaccacaacaatggccccggattgtgcatctgctcaggacaatggcagtccctcggccctggacgtctctttacaggacttcaacgttttctcaaacgattcctgcttacacctctcagatgccgtgtctccaagtttgtcagaatctgtagacagccccattggtttaactacggaggcctttgatttcttctctgagacgcttacaacaatcgacctgcaacacttgagctactaactctaactgaagtttcattatagggacgtcaatatctttctcacattaatggtctgtgtgtttaattgtgactttaaaaataggcctagaccattaatcaatgaggtaagtttttcaataatcaaattatcctttctgtttacagagaaaatatggcaggaaaaaaagtgatatttttcacgttttatttttgtatcgctcgacggcaaagcgccatattttcatagaataaatttgtacttgttattgaaagt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]