LOCUS       NM_001160384            1350 bp    mRNA    linear   VRT 16-SEP-2024
DEFINITION  Danio rerio NK2 homeobox 4a (nkx2.4a), transcript variant 2, mRNA.
ACCESSION   NM_001160384 XM_001923297 XM_001923299 XM_001923300
VERSION     NM_001160384.1
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 1350)
  AUTHORS   Yan YL, Titus T, Desvignes T, BreMiller R, Batzel P, Sydes J,
            Farnsworth D, Dillon D, Wegner J, Phillips JB, Peirce J, Dowd J,
            Buck CL, Miller A, Westerfield M and Postlethwait JH.
  CONSRTM   Undiagnosed Diseases Network
  TITLE     A fish with no sex: gonadal and adrenal functions partition between
            zebrafish NR5A1 co-orthologs
  JOURNAL   Genetics 217 (2) (2021)
   PUBMED   33724412
  REMARK    Erratum:[Genetics. 2021 May 17;218(1):. PMID: 33826717]
REFERENCE   2  (bases 1 to 1350)
  AUTHORS   Schredelseker T, Veit F, Dorsky RI and Driever W.
  TITLE     Bsx Is Essential for Differentiation of Multiple Neuromodulatory
            Cell Populations in the Secondary Prosencephalon
  JOURNAL   Front Neurosci 14, 525 (2020)
   PUBMED   32581684
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1350)
  AUTHORS   Murphy PJ, Wu SF, James CR, Wike CL and Cairns BR.
  TITLE     Placeholder Nucleosomes Underlie Germline-to-Embryo DNA Methylation
            Reprogramming
  JOURNAL   Cell 172 (5), 993-1006 (2018)
   PUBMED   29456083
REFERENCE   4  (bases 1 to 1350)
  AUTHORS   Pasquier J, Cabau C, Nguyen T, Jouanno E, Severac D, Braasch I,
            Journot L, Pontarotti P, Klopp C, Postlethwait JH, Guiguen Y and
            Bobe J.
  TITLE     Gene evolution and gene expression after whole genome duplication
            in fish: the PhyloFish database
  JOURNAL   BMC Genomics 17, 368 (2016)
   PUBMED   27189481
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 1350)
  AUTHORS   Manoli M and Driever W.
  TITLE     nkx2.1 and nkx2.4 genes function partially redundant during
            development of the zebrafish hypothalamus, preoptic region, and
            pallidum
  JOURNAL   Front Neuroanat 8, 145 (2014)
   PUBMED   25520628
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 1350)
  AUTHORS   Armant O, Marz M, Schmidt R, Ferg M, Diotel N, Ertzer R, Bryne JC,
            Yang L, Baader I, Reischl M, Legradi J, Mikut R, Stemple D, van
            IJcken W, van der Sloot A, Lenhard B, Strahle U and Rastegar S.
  TITLE     Genome-wide, whole mount in situ analysis of transcriptional
            regulators in zebrafish embryos
  JOURNAL   Dev Biol 380 (2), 351-362 (2013)
   PUBMED   23684812
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from BC162246.1.
            
            On or before May 24, 2009 this sequence version replaced
            XM_001923297.1, XM_001923299.1, XM_001923300.1.
            
            Transcript Variant: This variant (2) uses an alternate in-frame
            splice site in the coding region compared to variant 1. This
            results in a shorter protein (isoform b) compared to isoform 1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC162246.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA4476746, SAMEA4476776
                                           [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1350
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /db_xref="taxon:7955"
                     /chromosome="17"
                     /map="17"
     gene            1..1350
                     /gene="nkx2.4a"
                     /gene_synonym="fi48a12; wu:fi48a12; zgc:171531"
                     /note="NK2 homeobox 4a"
                     /db_xref="GeneID:562300"
                     /db_xref="ZFIN:ZDB-GENE-030131-6336"
     exon            1..552
                     /gene="nkx2.4a"
                     /gene_synonym="fi48a12; wu:fi48a12; zgc:171531"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    177..179
                     /gene="nkx2.4a"
                     /gene_synonym="fi48a12; wu:fi48a12; zgc:171531"
                     /note="upstream in-frame stop codon"
     CDS             183..1193
                     /gene="nkx2.4a"
                     /gene_synonym="fi48a12; wu:fi48a12; zgc:171531"
                     /note="isoform 2 is encoded by transcript variant 2; NK2
                     homeobox 4 a"
                     /codon_start=1
                     /product="NK2 homeobox 4a isoform 2"
                     /protein_id="NP_001153856.1"
                     /db_xref="GeneID:562300"
                     /db_xref="ZFIN:ZDB-GENE-030131-6336"
                     /translation="

MSLSPKHTTPFSVTDILSPIEETYKKFSGMESTGNLTSPLGAYRQPQVSQTGMQQHSMGHNATVATTYHMPHSVSQFSHSAMGGYCNGSIANMGDLPSYQETMRNSAAATGWYGANPDPRYSTSMNMTGMGTLTGMADTTKSIPPLHAAPRRKRRVLFSQAQVYELERRFKQQKYLSAPEREHLASMIHLTPTQVKIWFQNHRYKMKRQAKDKAAQQLQQEGNLCQQQQSPRRVAVPVLVKDGKPCQNGSNTPTPNQQQMQQQQNGGGVVLPTSSNSMNQHQSQQVNALVQAQDLEEMSPSPPSLHSQMNSMGQIDTSVDYTNNMVTSNLLYGRTW"

     misc_feature    636..806
                     /gene="nkx2.4a"
                     /gene_synonym="fi48a12; wu:fi48a12; zgc:171531"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     exon            553..1350
                     /gene="nkx2.4a"
                     /gene_synonym="fi48a12; wu:fi48a12; zgc:171531"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

tctggcgcctggctacaataaacctgagataagagtggccagggctcgcctccttctccaaggcgatcaatcggatctcaggcatactacaagcactctcttacgtcgacgtccacgagaacagagctgatacaacaacacggctgagctccaccaccaaatatctatctgctttctgaaccatgtcgctgagcccaaagcacacgacacctttctcagtgacagatattttgagcccaattgaggagacttacaagaagtttagtggcatggagagcactggaaacctcacatctccattgggagcctaccggcaacctcaggtgtcccagactggcatgcagcaacactccatgggccacaacgccactgttgcgaccacctaccacatgccacactcggtttcccagttctcgcacagtgcaatggggggctactgcaatggcagcattgccaacatgggggatctaccctcttatcaagaaactatgagaaatagcgcagcggcaacagggtggtacggcgccaatccagaccctagatactcaacaagtatgaacatgacaggaatgggcacgctgacaggcatggccgacaccaccaaatccatcccacctctacacgcagcgccaaggaggaaacgacgggtgctcttctctcaagcacaagtctacgaactggaaaggagatttaagcagcagaaatacctttcagcgccggaaagggaacatctggctagcatgatacatctcaccccgacgcaggtcaagatctggtttcagaatcatcgctacaagatgaagcgacaggccaaggacaaagcagcgcagcagcttcaacaggagggcaacctgtgtcaacaacagcagtcgccgaggagagtggctgtccctgtcttagtgaaggatggcaagccttgccaaaacggttccaacacgccgacgccaaaccaacagcaaatgcagcagcagcagaacggaggaggggtcgtgcttcctacctcgagcaattctatgaaccaacaccaaagccagcaggtcaacgcactggtccaggcccaagacctggaggaaatgtcccctagtccgccgtcacttcattcgcaaatgaacagtatgggccagatagacacttctgtagattacacaaataatatggtcacgtcaaatctgctttatggcagaacgtggtagaagaccagctattttttctccttcgcttcttctccacccataaacttaaaaatgatctgaattaaggactgcgcttgaggccaaaagcagacacgccgtgtacccgcgcgaagatttaaagcgggtgttcggatcaaaggagtgggtttttgggggt

//