LOCUS       NM_001128703            1064 bp    mRNA    linear   VRT 19-MAY-2024
DEFINITION  Danio rerio orthopedia homeobox a (otpa), mRNA.
ACCESSION   NM_001128703 XM_678094 XM_701814
VERSION     NM_001128703.1
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 1064)
  AUTHORS   Eugenin von Bernhardi,J., Biechl,D., Miek,L., Herget,U., Ryu,S. and
            Wullimann,M.F.
  TITLE     A versatile transcription factor: Multiple roles of orthopedia a
            (otpa) beyond its restricted localization in dopaminergic systems
            of developing and adult zebrafish (Danio rerio) brains
  JOURNAL   J Comp Neurol 530 (14), 2537-2561 (2022)
   PUBMED   35708548
REFERENCE   2  (bases 1 to 1064)
  AUTHORS   Zhao,G., Hu,J., Gao,M., Zhu,Y. and Hong,Y.
  TITLE     Excessive selenium affects neural development and locomotor
            behavior of zebrafish embryos
  JOURNAL   Ecotoxicol Environ Saf 238, 113611 (2022)
   PUBMED   35526456
REFERENCE   3  (bases 1 to 1064)
  AUTHORS   Gao,M., Hu,J., Zhu,Y., Wang,X., Zeng,S., Hong,Y. and Zhao,G.
  TITLE     Ferroptosis and Apoptosis Are Involved in the Formation of
            L-Selenomethionine-Induced Ocular Defects in Zebrafish Embryos
  JOURNAL   Int J Mol Sci 23 (9), 4783 (2022)
   PUBMED   35563172
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 1064)
  AUTHORS   Westphal,M., Panza,P., Kastenhuber,E., Wehrle,J. and Driever,W.
  TITLE     Wnt/beta-catenin signaling promotes neurogenesis in the
            diencephalospinal dopaminergic system of embryonic zebrafish
  JOURNAL   Sci Rep 12 (1), 1030 (2022)
   PUBMED   35046434
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 1064)
  AUTHORS   Iglesias Gonzalez,A.B., Jakobsson,J.E.T., Vieillard,J.,
            Lagerstrom,M.C., Kullander,K. and Boije,H.
  TITLE     Single Cell Transcriptomic Analysis of Spinal Dmrt3 Neurons in
            Zebrafish and Mouse Identifies Distinct Subtypes and Reveal Novel
            Subpopulations Within the dI6 Domain
  JOURNAL   Front Cell Neurosci 15, 781197 (2021)
   PUBMED   35002627
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 1064)
  AUTHORS   Lohr,H., Ryu,S. and Driever,W.
  TITLE     Zebrafish diencephalic A11-related dopaminergic neurons share a
            conserved transcriptional network with neuroendocrine cell lineages
  JOURNAL   Development 136 (6), 1007-1017 (2009)
   PUBMED   19234064
REFERENCE   7  (bases 1 to 1064)
  AUTHORS   Blechman,J., Borodovsky,N., Eisenberg,M., Nabel-Rosen,H., Grimm,J.
            and Levkowitz,G.
  TITLE     Specification of hypothalamic neurons by dual regulation of the
            homeodomain protein Orthopedia
  JOURNAL   Development 134 (24), 4417-4426 (2007)
   PUBMED   18003738
REFERENCE   8  (bases 1 to 1064)
  AUTHORS   Ryu,S., Mahler,J., Acampora,D., Holzschuh,J., Erhardt,S.,
            Omodei,D., Simeone,A. and Driever,W.
  TITLE     Orthopedia homeodomain protein is essential for diencephalic
            dopaminergic neuron development
  JOURNAL   Curr Biol 17 (10), 873-880 (2007)
   PUBMED   17481897
  REMARK    Erratum:[Curr Biol. 2008 Feb 26;18(4):310]
REFERENCE   9  (bases 1 to 1064)
  AUTHORS   Kikuta,H., Laplante,M., Navratilova,P., Komisarczuk,A.Z.,
            Engstrom,P.G., Fredman,D., Akalin,A., Caccamo,M., Sealy,I.,
            Howe,K., Ghislain,J., Pezeron,G., Mourrain,P., Ellingsen,S.,
            Oates,A.C., Thisse,C., Thisse,B., Foucher,I., Adolf,B., Geling,A.,
            Lenhard,B. and Becker,T.S.
  TITLE     Genomic regulatory blocks encompass multiple neighboring genes and
            maintain conserved synteny in vertebrates
  JOURNAL   Genome Res 17 (5), 545-555 (2007)
   PUBMED   17387144
REFERENCE   10 (bases 1 to 1064)
  AUTHORS   Del Giacco,L., Sordino,P., Pistocchi,A., Andreakis,N., Tarallo,R.,
            Di Benedetto,B. and Cotelli,F.
  TITLE     Differential regulation of the zebrafish orthopedia 1 gene during
            fate determination of diencephalic neurons
  JOURNAL   BMC Dev Biol 6, 50 (2006)
   PUBMED   17074092
  REMARK    Publication Status: Online-Only
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from BC162329.1.
            
            On or before Jul 31, 2008 this sequence version replaced
            XM_678094.3, XM_701814.3.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC162329.1, EH589867.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA3505370, SAMEA3505371
                                           [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1064
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /db_xref="taxon:7955"
                     /chromosome="21"
                     /map="21"
     gene            1..1064
                     /gene="otpa"
                     /note="orthopedia homeobox a"
                     /db_xref="GeneID:560759"
                     /db_xref="ZFIN:ZDB-GENE-070216-1"
     exon            1..99
                     /gene="otpa"
                     /inference="alignment:Splign:2.1.0"
     CDS             24..1022
                     /gene="otpa"
                     /note="otp; orthopedia homolog a; otp2; otpb"
                     /codon_start=1
                     /product="orthopedia homeobox a"
                     /protein_id="NP_001122175.1"
                     /db_xref="GeneID:560759"
                     /db_xref="ZFIN:ZDB-GENE-070216-1"
                     /translation="

MLSHADLLDARLGELSTPNSGLQLYWMKDAAAELLGHREALKCRLGGGGTDPVHPGDLAPVSDAVEGATLLPGDDINSAGSNPPGVAVNSKDQEKQQQQQQNPTQSSSQQSQKQKRHRTRFTPAQLNELERSFAKTHYPDIFMREELALRIGLTESRVQVWFQNRRAKWKKRKKTTNVFRAPGTLLPTHHGLPQFPSAAAAAAAMGDSLCSFHANDTRWAAAGMPGVSQLQLPPALGRQQAMAQSLSQCSLGAGPPPNSMSLSNMSSNGSGLQSHLYQPTFPGMVPASLSGPTNVTGSPQLCSSPDTDVWRGTSIASLRRKALEHTVSMSFT"

     misc_feature    369..521
                     /gene="otpa"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     misc_feature    951..1004
                     /gene="otpa"
                     /note="OAR motif; Region: OAR; pfam03826"
                     /db_xref="CDD:461067"
     exon            100..500
                     /gene="otpa"
                     /inference="alignment:Splign:2.1.0"
     exon            501..1064
                     /gene="otpa"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

atttcgccctggagcggtgcgcgatgctttcgcatgccgacctgctggatgctcgcctcggtgagttatcaacgccaaactccggtctgcaactctactggatgaaggatgccgcggctgagcttctgggtcacagggaggcattaaaatgcaggctgggtggcggtgggactgacccggtccaccccggagatctagccccggtctccgatgcggtggaaggggccacccttctccccggagacgatatcaacagtgctggatccaatccgccgggtgtagcggtcaacagtaaggatcaagagaagcaacagcagcagcaacagaaccccacccagtcctccagccagcagagtcagaaacaaaaacggcaccggactcgctttactccggctcagcttaacgagctggaacgcagcttcgccaaaacccactatccggacatcttcatgcgcgaggagctcgcactccggatcggcttgacggaatcacgcgtgcaggtttggtttcagaaccgacgcgccaaatggaagaagcgcaagaagaccaccaacgtgttccgcgctccgggcactctgctgcccactcaccacggcctgccgcagttcccctccgctgcggcggccgcagcagccatgggcgatagcctatgctctttccacgcgaacgacacgcgctgggcggcggccggaatgccgggagtctctcagctgcagttaccgcccgccctaggccgacaacaagccatggcacagtctctgtctcagtgcagcctgggcgccggaccgcctcccaactccatgagcctgtctaacatgtcctccaacggctccggcctccagtcccacctctaccaacccaccttccccggaatggtgcccgcgtcgctctccggccccaccaatgtgaccggctcaccgcagctgtgtagctccccggacacggacgtctggagagggacgagcatcgcgtccctgcgccgcaaagcgctcgagcacacagtgtccatgagcttcacctaatattttgacgtgccgtttcacctcctgtttctcgtccaccca

//