GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-01-08 21:49:36, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       NM_001122973            1176 bp    mRNA    linear   VRT 05-JUN-2025
DEFINITION  Danio rerio LIM homeobox 4 (lhx4), mRNA.
ACCESSION   NM_001122973 XM_695590
VERSION     NM_001122973.1
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 1176)
  AUTHORS   Roisman-Geller,N., Pisanty,O., Weinberger,A., Gajbhiye,D.S.,
            Golan,M. and Gothilf,Y.
  TITLE     Combined Pituitary Hormone Deficiency in lhx4-Knockout Zebrafish
  JOURNAL   Int J Mol Sci 25 (13), 7332 (2024)
   PUBMED   39000439
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1176)
  AUTHORS   Yan,C.Y., Wu,F.Y., Sun,F., Fang,Y., Zhang,R.J., Zhang,C.R.,
            Zhang,C.X., Wang,Z., Yang,R.M., Yang,L., Dong,M., Zhang,Q.Y.,
            Ye,X.P., Song,H.D. and Zhao,S.X.
  TITLE     The isl2a transcription factor regulates pituitary development in
            zebrafish
  JOURNAL   Front Endocrinol (Lausanne) 14, 920548 (2023)
   PUBMED   36824359
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1176)
  AUTHORS   Guo,R., Ge,K., Wang,Y., Lu,M., Li,F., Tian,L., Gan,L. and Sheng,D.
  TITLE     LIM Homeobox 4 (lhx4) regulates retinal neural differentiation and
            visual function in zebrafish
  JOURNAL   Sci Rep 11 (1), 1977 (2021)
   PUBMED   33479361
  REMARK    GeneRIF: LIM Homeobox 4 (lhx4) regulates retinal neural
            differentiation and visual function in zebrafish.
            Erratum:[Sci Rep. 2025 Apr 15;15(1):12967. doi:
            10.1038/s41598-025-90120-1. PMID: 40234470]
            Publication Status: Online-Only
REFERENCE   4  (bases 1 to 1176)
  AUTHORS   Postlethwait,J.H., Farnsworth,D.R. and Miller,A.C.
  TITLE     An intestinal cell type in zebrafish is the nexus for the
            SARS-CoV-2 receptor and the Renin-Angiotensin-Aldosterone System
            that contributes to COVID-19 comorbidities
  JOURNAL   bioRxiv (2020)
   PUBMED   32908984
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 1176)
  AUTHORS   Bayes,A., Collins,M.O., Reig-Viader,R., Gou,G., Goulding,D.,
            Izquierdo,A., Choudhary,J.S., Emes,R.D. and Grant,S.G.
  TITLE     Evolution of complexity in the zebrafish synapse proteome
  JOURNAL   Nat Commun 8, 14613 (2017)
   PUBMED   28252024
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 1176)
  AUTHORS   Elkon,R., Milon,B., Morrison,L., Shah,M., Vijayakumar,S.,
            Racherla,M., Leitch,C.C., Silipino,L., Hadi,S., Weiss-Gayet,M.,
            Barras,E., Schmid,C.D., Ait-Lounis,A., Barnes,A., Song,Y.,
            Eisenman,D.J., Eliyahu,E., Frolenkov,G.I., Strome,S.E., Durand,B.,
            Zaghloul,N.A., Jones,S.M., Reith,W. and Hertzano,R.
  TITLE     RFX transcription factors are essential for hearing in mice
  JOURNAL   Nat Commun 6, 8549 (2015)
   PUBMED   26469318
  REMARK    Publication Status: Online-Only
REFERENCE   7  (bases 1 to 1176)
  AUTHORS   Diotel,N., Rodriguez Viales,R., Armant,O., Marz,M., Ferg,M.,
            Rastegar,S. and Strahle,U.
  TITLE     Comprehensive expression map of transcription regulators in the
            adult zebrafish telencephalon reveals distinct neurogenic niches
  JOURNAL   J Comp Neurol 523 (8), 1202-1221 (2015)
   PUBMED   25556858
REFERENCE   8  (bases 1 to 1176)
  AUTHORS   Seredick,S., Hutchinson,S.A., Van Ryswyk,L., Talbot,J.C. and
            Eisen,J.S.
  TITLE     Lhx3 and Lhx4 suppress Kolmer-Agduhr interneuron characteristics
            within zebrafish axial motoneurons
  JOURNAL   Development 141 (20), 3900-3909 (2014)
   PUBMED   25231761
  REMARK    GeneRIF: Lhx3 and Lhx4 have roles in suppressing Kolmer-Agduhr
            interneuron characteristics within zebrafish axial motoneurons
REFERENCE   9  (bases 1 to 1176)
  AUTHORS   Miyasaka,N., Morimoto,K., Tsubokawa,T., Higashijima,S., Okamoto,H.
            and Yoshihara,Y.
  TITLE     From the olfactory bulb to higher brain centers: genetic
            visualization of secondary olfactory pathways in zebrafish
  JOURNAL   J Neurosci 29 (15), 4756-4767 (2009)
   PUBMED   19369545
REFERENCE   10 (bases 1 to 1176)
  AUTHORS   Hutchinson,S.A. and Eisen,J.S.
  TITLE     Islet1 and Islet2 have equivalent abilities to promote motoneuron
            formation and to specify motoneuron subtype identity
  JOURNAL   Development 133 (11), 2137-2147 (2006)
   PUBMED   16672347
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from
            JBMGRA010000008.1.
            
            On Apr 4, 2008 this sequence version replaced XM_695590.2.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: GFIL01014454.1,
                                           SRR32588734.2421602.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA4476810 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-85                JBMGRA010000008.1  16247527-16247611   c
            86-257              JBMGRA010000008.1  16235609-16235780   c
            258-460             JBMGRA010000008.1  16230661-16230863   c
            461-615             JBMGRA010000008.1  16223845-16223999   c
            616-787             JBMGRA010000008.1  16221539-16221710   c
            788-1176            JBMGRA010000008.1  16218090-16218478   c
FEATURES             Location/Qualifiers
     source          1..1176
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /strain="Tuebingen"
                     /db_xref="taxon:7955"
                     /chromosome="8"
                     /map="8"
     gene            1..1176
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /note="LIM homeobox 4"
                     /db_xref="GeneID:571943"
                     /db_xref="ZFIN:ZDB-GENE-060728-1"
     CDS             1..1176
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /codon_start=1
                     /product="LIM/homeobox protein Lhx4"
                     /protein_id="NP_001116445.1"
                     /db_xref="GeneID:571943"
                     /db_xref="ZFIN:ZDB-GENE-060728-1"
                     /translation="
MKMMQSAAVLPGESAVKGLPDILGVPLQQIPQCAGCSQHILDKFILKVLDRHWHSKCLKCADCHALLADKCFSRAGNVYCKEDFFKRFGTKCASCQQGIPPTQVVRKAQDFVYHLHCFACVMCSRQLATGDEFYLMEDGRLVCKEDYETAKQNDDSETGAKRPRTTITAKQLETLKSAYKNSPKPARHVREQLSSETGLDMRVVQVWFQNRRAKEKRLKKDAGRHRWGQFYKSVKRNRGSSKTEKESSADDAGLSDSELSFRDDQILSDLGHANGLYGSVGDVSNGNMLNGSFSLDGGGQPYHDLRAGSPYGLPQSPSSITSLPGHTPLLNNLGFSMDGLMGQAGQPSVGQALRAMAGGPTSDLSTGSSTGYPDFPTSPASWLDEMDHSQF"
     misc_feature    97..252
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /note="The first LIM domain of Lhx4; Region: LIM1_Lhx4;
                     cd09468"
                     /db_xref="CDD:188852"
     misc_feature    order(97..99,106..108,160..162,169..171,178..180,187..189,
                     238..240,247..249)
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:188852"
     misc_feature    274..441
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /note="The second LIM domain of Lhx3-Lhx4 family; Region:
                     LIM2_Lhx3_Lhx4; cd09376"
                     /db_xref="CDD:188762"
     misc_feature    order(274..276,283..285,340..342,349..351,358..360,
                     367..369,427..429,436..438)
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:188762"
     misc_feature    order(310..312,385..387)
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /note="Isl binding site; other site"
                     /db_xref="CDD:188762"
     misc_feature    481..651
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     exon            1..85
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /inference="alignment:Splign:2.1.0"
     exon            86..257
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /inference="alignment:Splign:2.1.0"
     exon            258..460
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /inference="alignment:Splign:2.1.0"
     exon            461..615
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /inference="alignment:Splign:2.1.0"
     exon            616..787
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /inference="alignment:Splign:2.1.0"
     exon            788..1176
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
atgaaaatgatgcaaagtgcggctgtgctgcccggcgagagcgcggtgaagggtctgccggacatcctcggagtgccactgcaacaaatccctcagtgcgcaggctgcagtcaacacatcctggataagttcatcctaaaggttctggatcggcactggcactcaaaatgcctgaagtgcgccgactgccacgcgctcctggcggacaaatgtttctctcgcgccgggaatgtctactgcaaagaggacttcttcaagcgtttcgggacaaagtgtgcatcgtgccagcaggggattcctcctacacaggtggtccggaaagctcaggactttgtgtaccatcttcactgttttgcatgtgtgatgtgcagcagacagttggccactggagatgagttctacctcatggaggacggcagactcgtgtgcaaagaggactacgaaacagccaagcagaacgatgattcagaaacaggagcaaaacgtccacgcaccaccatcacagccaaacagctggaaactctcaaaagcgcctataagaactcgccaaaaccagcaagacacgtgcgagagcaactttcctcagaaacgggcctggacatgagagtggtgcaggtgtggtttcagaacagacgggcaaaagaaaaacggctgaagaaagacgcgggccggcatcggtggggtcagttctacaaaagcgtcaaacgcaacagaggctccagtaaaacagagaaggaaagctcagccgacgatgcaggactcagtgacagtgagctcagtttcagagatgatcagatcctgtcagacttgggtcatgctaacggcctgtacggaagtgtcggcgacgtctctaatggtaacatgctcaacgggagcttctctttggatggaggcgggcagccttaccatgacctgcgggcagggagtccctatggcctgcctcagtcgccctcgtccatcacttccctgccaggccacactcctctactcaacaacttaggcttcagcatggacggcctcatgggtcaggccggtcagcccagtgtgggtcaagctctgagagccatggccggaggccccacctctgacctatccacaggaagcagcacgggatacccagacttccccaccagcccggcctcatggctcgatgaaatggaccactctcagttctga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]