LOCUS       XM_018813576            2038 bp    mRNA    linear   INV 22-OCT-2018
DEFINITION  PREDICTED: Ciona intestinalis transcription factor protein (meis),
            transcript variant X2, mRNA.
ACCESSION   XM_018813576
VERSION     XM_018813576.2
DBLINK      BioProject: PRJNA187185
KEYWORDS    RefSeq.
SOURCE      Ciona intestinalis (vase tunicate)
  ORGANISM  Ciona intestinalis
            Eukaryota; Metazoa; Chordata; Tunicata; Ascidiacea; Phlebobranchia;
            Cionidae; Ciona.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_020175.2) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Oct 22, 2018 this sequence version replaced XM_018813576.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Ciona intestinalis Annotation
                                           Release 104
            Annotation Version          :: 104
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2038
                     /organism="Ciona intestinalis"
                     /mol_type="mRNA"
                     /db_xref="taxon:7719"
                     /chromosome="10"
     gene            1..2038
                     /gene="meis"
                     /note="transcription factor protein; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 31
                     ESTs, 1 Protein, and 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 68 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:778904"
     CDS             122..1789
                     /gene="meis"
                     /codon_start=1
                     /product="transcription factor protein isoform X2"
                     /protein_id="XP_018669121.1"
                     /db_xref="GeneID:778904"
                     /translation="

MAAVTCFDDGMAHFGGMNDLRDMSQPSSGAGGLYGGDLNRSIPQLGHLSHGHSSMSHFSASTPGSAHPMSTMHATQSSGSSTSMDERLSDSERVNLKGDKDAIYSHPLFPLLALVFEKCELATCTPRDPGVTGGDVCSSDSFNDDIACFAKQIHSENRPITFDPNNEIDNLMILSIQVLRFHLLELEKVHELCQNFTSRYINCLKGKMPIDLVIEDREGGVPSKLEANEPTSSGSEQSFYNQETPSHPSMDTNAMHAGNMGGGGPVAIPAQSSSHHHLHTPSTHQHQQQHHHNADSSPTGSTIEGSTYSGEGGNEDDSDPGKKPQQKKRGIFPKQATNIMRAWLFQNLTHPYPTEEQKKSLANQTGLTILQVNNWFINARRRIVQPMIDQSNRAVSNAMGPYSPDGQSMGGFLCMDGQPPHMAMRHPGWPSGFQSMPGAADMMAAQHISMAAANSSFNPTSTMSPSHHPSGLHHQLRHPPSQAMLLPGSHQHHHAAAAAAAMMMPHHAAAVAAAAGHSAVTGMGHHPHHGHHLHHSGQSTMNPADMSSHMLGHTC"

     misc_feature    518..778
                     /gene="meis"
                     /note="N-terminal of Homeobox Meis and PKNOX1; Region:
                     Meis_PKNOX_N; pfam16493"
                     /db_xref="CDD:465140"
     misc_feature    order(1100..1111,1115..1117,1175..1177,1193..1195,
                     1232..1234,1238..1243,1250..1255,1259..1267)
                     /gene="meis"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(1103..1105,1112..1114,1241..1243,1250..1255,
                     1262..1264)
                     /gene="meis"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    1151..1267
                     /gene="meis"
                     /note="Homeobox KN domain; Region: Homeobox_KN; pfam05920"
                     /db_xref="CDD:428673"
ORIGIN      

acctgcgtgctttcgtttcagatcgttgataggtgcctaactcagatttgaattagttttactgtacattttgagatagtgtagccatactacaccagaattaacggatctgaagtttagcatggcagcagtcacatgttttgacgacggaatggcgcacttcggcggcatgaacgacctaagagatatgagccaaccgtcatcgggcgcgggcggactgtacggcggggatttgaaccgctcgatcccgcagctcgggcatctttcgcacgggcactcgtcgatgtcacatttctcagcgagtacacctggatctgcacatccaatgtcaactatgcatgcgacgcagtcgtcaggttcatctacgagtatggacgaaagattaagcgactcggaacgcgtcaatctgaagggagacaaggacgccatttattcacaccccctgttcccgctgctggctctggtcttcgaaaaatgtgagctagcgacctgtacaccacgtgaccccggcgtaacaggcggtgacgtatgctcttccgattcattcaacgacgacattgcgtgttttgctaagcagattcattccgaaaaccgaccaatcaccttcgaccccaacaacgaaatcgacaacctgatgatcctgtctattcaggttctgcgtttccacctgcttgagttagaaaaggttcacgaactttgtcagaacttcacatcaaggtatattaactgcctaaaaggaaaaatgcccattgacctggtcatagaggatcgggaagggggagtcccctcgaaactggaagcgaatgagccgacctcatcaggctccgaacaatcattctataaccaagaaacaccttcccaccctagtatggatacaaacgctatgcacgcgggtaacatgggcggtggggggcctgtggcaataccagcacagtcgtcatcccatcaccacctacatacaccgtcaacacatcagcaccaacagcaacatcaccataacgcggactccagtccaacaggaagcaccatagaagggagtacatactccggggaaggaggtaacgaagatgattccgatcccggcaagaaaccccagcagaagaaaagaggaatcttcccaaaacaagcgactaatattatgagagcttggctttttcaaaacttaacgcacccttacccaaccgaagaacaaaagaaatctttagctaaccaaaccgggcttacgatactgcaagtgaacaactggttcattaacgcgagacggagaatagtccaaccgatgatcgaccaatccaatagagcagtgagcaatgctatgggaccatacagccctgatggtcaatctatgggcggcttcttatgcatggacggacagccaccgcacatggcaatgcgtcacccaggatggccgtcaggtttccaaagcatgcctggcgcagctgatatgatggcagcacagcatatatcaatggcagctgcaaacagctcattcaacccgacctccactatgtcaccttcacaccacccttcaggacttcatcaccaacttcgacaccccccctcacaggccatgctgcttcccgggtctcaccagcaccaccacgcggcagccgcagcagcagcaatgatgatgccacaccatgcagcggcggtggctgcggccgctggacacagcgcagtaacaggcatgggccaccacccgcaccacggccaccacctacaccattcaggccaatctacgatgaatccagcggacatgtcgtctcatatgctcggccatacttgctagcaaagtctccttaaatccgagcggtagctcgtgagcaaacgttggagttaacgcgcggatgaactccatccagacagcgcgtaccacgggcggattgcacctaagggatggctacccgcctcgtgacaaccaatggttccagtcagtttgctacctcttattagcgttcgaccacgagagcgctgctcacaaagagtgttcgtcttttcggtcaaaccacgtgacccggcgtcaccggcgcaacgtgcc

//