2024-06-28 23:30:47, GGRNA.v2 : RefSeq release 224 (May, 2024)
LOCUS NM_128424 2162 bp mRNA linear PLN 20-OCT-2022 DEFINITION Arabidopsis thaliana 3-ketoacyl-CoA synthase 12 (KCS12), mRNA. ACCESSION NM_128424 VERSION NM_128424.3 DBLINK BioProject: PRJNA116 BioSample: SAMN03081427 KEYWORDS RefSeq. SOURCE Arabidopsis thaliana (thale cress) ORGANISM Arabidopsis thaliana Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Camelineae; Arabidopsis. REFERENCE 1 (bases 1 to 2162) AUTHORS Lin,X., Kaul,S., Rounsley,S., Shea,T.P., Benito,M.I., Town,C.D., Fujii,C.Y., Mason,T., Bowman,C.L., Barnstead,M., Feldblyum,T.V., Buell,C.R., Ketchum,K.A., Lee,J., Ronning,C.M., Koo,H.L., Moffat,K.S., Cronin,L.A., Shen,M., Pai,G., Van Aken,S., Umayam,L., Tallon,L.J., Gill,J.E., Adams,M.D., Carrera,A.J., Creasy,T.H., Goodman,H.M., Somerville,C.R., Copenhaver,G.P., Preuss,D., Nierman,W.C., White,O., Eisen,J.A., Salzberg,S.L., Fraser,C.M. and Venter,J.C. TITLE Sequence and analysis of chromosome 2 of the plant Arabidopsis thaliana JOURNAL Nature 402 (6763), 761-768 (1999) PUBMED 10617197 REFERENCE 2 (bases 1 to 2162) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (19-OCT-2022) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 2162) AUTHORS Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M., Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R., Vaughn,M. and Town,C.D. TITLE Direct Submission JOURNAL Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute, 9704 Medical Center Dr, Rockville, MD 20850, USA REMARK Protein update by submitter REFERENCE 4 (bases 1 to 2162) AUTHORS Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E. CONSRTM TAIR TITLE Direct Submission JOURNAL Submitted (18-FEB-2011) Department of Plant Biology, Carnegie Institution, 260 Panama Street, Stanford, CA, USA COMMENT REVIEWED REFSEQ: This record has been curated by TAIR and Araport. This record is derived from an annotated genomic sequence (NC_003071). On Sep 12, 2016 this sequence version replaced NM_128424.2. FEATURES Location/Qualifiers source 1..2162 /organism="Arabidopsis thaliana" /mol_type="mRNA" /db_xref="taxon:3702" /chromosome="2" /ecotype="Columbia" gene 1..2162 /gene="KCS12" /locus_tag="AT2G28630" /gene_synonym="3-ketoacyl-CoA synthase 12; T8O18.8; T8O18_8" /note="Encodes KCS12, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids)." /db_xref="Araport:AT2G28630" /db_xref="GeneID:817412" /db_xref="TAIR:AT2G28630" CDS 269..1699 /gene="KCS12" /locus_tag="AT2G28630" /gene_synonym="3-ketoacyl-CoA synthase 12; T8O18.8; T8O18_8" /codon_start=1 /product="3-ketoacyl-CoA synthase 12" /protein_id="NP_180431.1" /db_xref="Araport:AT2G28630" /db_xref="GeneID:817412" /db_xref="TAIR:AT2G28630" /translation="
MDLLFLFFSLLLSYLFFKIWKLIDSKQDKDCYILDYQCHKPTDDRMVSTQFSGEIIYRNQNLGLTEYKFLLKAIVSSGIGEQTYAPRLVFEGREERPSLQDGISEMEEFYVDSIGKLLERNQISPKDIDILVVNVSMLSSTPSLASRIINHYKMRDDVKVFNLTGMGCSASLISVDIVKNIFKSYANKLALVATSESLSPNWYSGNNRSMILANCLFRSGGCAILLTNKRSLRKKAMFKLKCMVRTHHGAREESYNCCIQAEDEQGRVGFYLGKNLPKAATRAFVENLKVITPKILPVTELIRFMLKLLIKKIKIRQNPSKGSTNLPPGTPLKAGINFKTGIEHFCIHTGGKAVIDGIGHSLDLNEYDIEPARMTLHRFGNTSASSLWYVLAYMEAKKRLKRGDRVFMISFGAGFKCNSCVWEVVRDLTGGESKGNVWNHCIDDYPPKSILNPYLEKFGWIQDEDPDTFKVPDAFM"
misc_feature 335..1183 /gene="KCS12" /locus_tag="AT2G28630" /gene_synonym="3-ketoacyl-CoA synthase 12; T8O18.8; T8O18_8" /note="FAE1/Type III polyketide synthase-like protein; Region: FAE1_CUT1_RppA; pfam08392" /db_xref="CDD:429970" misc_feature order(422..424,431..436,917..919,1136..1138,1319..1327) /gene="KCS12" /locus_tag="AT2G28630" /gene_synonym="3-ketoacyl-CoA synthase 12; T8O18.8; T8O18_8" /note="malonyl-CoA binding site [chemical binding]; other site" /db_xref="CDD:238427" misc_feature order(551..556,563..565,686..691,704..706,716..718, 734..754,764..769,794..799,806..808,815..823,1028..1030, 1034..1042,1076..1087,1514..1516) /gene="KCS12" /locus_tag="AT2G28630" /gene_synonym="3-ketoacyl-CoA synthase 12; T8O18.8; T8O18_8" /note="dimer interface [polypeptide binding]; other site" /db_xref="CDD:238427" misc_feature order(770..772,1310..1312,1409..1411) /gene="KCS12" /locus_tag="AT2G28630" /gene_synonym="3-ketoacyl-CoA synthase 12; T8O18.8; T8O18_8" /note="active site" /db_xref="CDD:238427" misc_feature order(854..862,920..922,1070..1078,1133..1138,1415..1417, 1505..1507) /gene="KCS12" /locus_tag="AT2G28630" /gene_synonym="3-ketoacyl-CoA synthase 12; T8O18.8; T8O18_8" /note="product binding site [active]" /db_xref="CDD:238427" misc_feature 1265..1537 /gene="KCS12" /locus_tag="AT2G28630" /gene_synonym="3-ketoacyl-CoA synthase 12; T8O18.8; T8O18_8" /note="Beta-ketoacyl synthase, C-terminal domain; Region: Ketoacyl-synt_C; cl21486" /db_xref="CDD:451266" ORIGIN
acttgttatatcttaccgtcaacgaaaatttattaaaattccctttcttcaaaaatactattaaaactcaatggttatgtagaacccactgggaaattcagagctggcgtttcctcatccattctcatatattctcttatataatcccctttacaatctccacttcatttccatgcatcttactcacttcatcatctcttcttaaaccccaaaacaaacaaacaaacaaacaaaaaataccaaaacaaagaagaaaaaaaaaataactatggatcttctctttctctttttctctcttctcctctcttacctctttttcaagatctggaaactcatagactcaaagcaagacaaagattgctacattttagactaccaatgtcataaaccaaccgacgatcgaatggtgagcactcaattcagtggagagatcatttatcgaaaccaaaaccttggtttaaccgaatacaagttccttctcaaagccatagtaagctcagggattggagaacaaacctacgctccaagacttgtctttgaaggtcgagaagagcgtccttcgttacaagatgggatctccgagatggaagagttctacgtggacagcatcggaaaactcctggagagaaatcaaatatctcctaaagacatagacatcctcgtagtcaacgtctccatgctctcttcaacgccatctttagcttcaagaatcattaaccattacaagatgagagacgacgtcaaagtcttcaacttgaccgggatgggatgcagcgcaagtctaatctccgtagacattgtcaagaacatttttaagagctacgcaaacaagttagctcttgttgccacctccgagtctttgagccctaattggtatagcggaaacaaccgttcaatgatcttagccaactgtttgttccggtccggtggatgtgctattctcttgactaacaaacgtagcttgagaaagaaagcaatgtttaaactcaagtgtatggtacggactcaccatggagctagagaggagtcttataattgttgcatccaagccgaagatgaacaaggccgtgtcgggttttacttggggaagaatctaccaaaagccgctactcgtgcttttgtagaaaacctcaaggttataacacccaagattcttcccgtaaccgagcttataaggttcatgttaaagcttcttatcaagaaaatcaagattcgtcaaaaccctagcaagggctccacgaatctcccaccggggactccattaaaggcaggaatcaacttcaagaccgggatcgaacatttttgcatacataccggaggaaaagctgtgattgatgggattggacatagcttggatttaaacgagtatgatattgaacctgcgaggatgactcttcaccggtttggcaatacttcggcgagtagtttgtggtatgtgttggcttacatggaggccaagaagagattgaagagaggagatagagtttttatgataagctttggagctggttttaagtgtaatagctgcgtttgggaagttgtgagagatcttactggtggtgaatcaaaaggaaatgtgtggaatcattgcattgatgattatccaccaaaatcgattctgaatccttatttggagaagtttggctggattcaagatgaagatcctgacactttcaaggtccctgacgctttcatgtaaaacgtttacgcacaaaaacgcaaacgcaaacgcaaaaacaacacaaggtgatacaatattctctctttcttaatttcttcttttttgcctttagttaaaatttttacgtttttttgtttaaatggattggaaaggagatatgaatgtaaaagaaactttaattagttttttttttaatatgattttttttgggtgttataatttgttaattacatactttgaaataagggttttaagggacatgcacttccaatacgatgagaatttactaatttgccatcatattggaatgctgccttctttttttcttgttaaatgttgtatcaattttatattttttgtaatgttcatttttcactctatgttgtacttgtttcgcattaactcaagcttgccactgtacatattcattctatttttctgtaacttaaaaaaaaaactatacaagaaggaaattaaggaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]