ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-29 15:29:32, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NM_116532 1055 bp mRNA linear PLN 20-OCT-2022
DEFINITION Arabidopsis thaliana endoplasmic reticulum auxin binding protein 1
(ABP1), mRNA.
ACCESSION NM_116532
VERSION NM_116532.3
DBLINK BioProject: PRJNA116
BioSample: SAMN03081427
KEYWORDS RefSeq.
SOURCE Arabidopsis thaliana (thale cress)
ORGANISM Arabidopsis thaliana
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
Camelineae; Arabidopsis.
REFERENCE 1 (bases 1 to 1055)
AUTHORS Mayer,K., Schuller,C., Wambutt,R., Murphy,G., Volckaert,G.,
Pohl,T., Dusterhoft,A., Stiekema,W., Entian,K.D., Terryn,N.,
Harris,B., Ansorge,W., Brandt,P., Grivell,L., Rieger,M.,
Weichselgartner,M., de Simone,V., Obermaier,B., Mache,R.,
Muller,M., Kreis,M., Delseny,M., Puigdomenech,P., Watson,M.,
Schmidtheini,T., Reichert,B., Portatelle,D., Perez-Alonso,M.,
Boutry,M., Bancroft,I., Vos,P., Hoheisel,J., Zimmermann,W.,
Wedler,H., Ridley,P., Langham,S.A., McCullagh,B., Bilham,L.,
Robben,J., Van der Schueren,J., Grymonprez,B., Chuang,Y.J.,
Vandenbussche,F., Braeken,M., Weltjens,I., Voet,M., Bastiaens,I.,
Aert,R., Defoor,E., Weitzenegger,T., Bothe,G., Ramsperger,U.,
Hilbert,H., Braun,M., Holzer,E., Brandt,A., Peters,S., van
Staveren,M., Dirske,W., Mooijman,P., Klein Lankhorst,R., Rose,M.,
Hauf,J., Kotter,P., Berneiser,S., Hempel,S., Feldpausch,M.,
Lamberth,S., Van den Daele,H., De Keyser,A., Buysshaert,C.,
Gielen,J., Villarroel,R., De Clercq,R., Van Montagu,M., Rogers,J.,
Cronin,A., Quail,M., Bray-Allen,S., Clark,L., Doggett,J., Hall,S.,
Kay,M., Lennard,N., McLay,K., Mayes,R., Pettett,A.,
Rajandream,M.A., Lyne,M., Benes,V., Rechmann,S., Borkova,D.,
Blocker,H., Scharfe,M., Grimm,M., Lohnert,T.H., Dose,S., de
Haan,M., Maarse,A., Schafer,M., Muller-Auer,S., Gabel,C., Fuchs,M.,
Fartmann,B., Granderath,K., Dauner,D., Herzl,A., Neumann,S.,
Argiriou,A., Vitale,D., Liguori,R., Piravandi,E., Massenet,O.,
Quigley,F., Clabauld,G., Mundlein,A., Felber,R., Schnabl,S.,
Hiller,R., Schmidt,W., Lecharny,A., Aubourg,S., Chefdor,F.,
Cooke,R., Berger,C., Montfort,A., Casacuberta,E., Gibbons,T.,
Weber,N., Vandenbol,M., Bargues,M., Terol,J., Torres,A.,
Perez-Perez,A., Purnelle,B., Bent,E., Johnson,S., Tacon,D.,
Jesse,T., Heijnen,L., Schwarz,S., Scholler,P., Heber,S., Francs,P.,
Bielke,C., Frishman,D., Haase,D., Lemcke,K., Mewes,H.W.,
Stocker,S., Zaccaria,P., Bevan,M., Wilson,R.K., de la Bastide,M.,
Habermann,K., Parnell,L., Dedhia,N., Gnoj,L., Schutz,K., Huang,E.,
Spiegel,L., Sehkon,M., Murray,J., Sheet,P., Cordes,M.,
Abu-Threideh,J., Stoneking,T., Kalicki,J., Graves,T., Harmon,G.,
Edwards,J., Latreille,P., Courtney,L., Cloud,J., Abbott,A.,
Scott,K., Johnson,D., Minx,P., Bentley,D., Fulton,B., Miller,N.,
Greco,T., Kemp,K., Kramer,J., Fulton,L., Mardis,E., Dante,M.,
Pepin,K., Hillier,L., Nelson,J., Spieth,J., Ryan,E., Andrews,S.,
Geisel,C., Layman,D., Du,H., Ali,J., Berghoff,A., Jones,K.,
Drone,K., Cotton,M., Joshu,C., Antonoiu,B., Zidanic,M., Strong,C.,
Sun,H., Lamar,B., Yordan,C., Ma,P., Zhong,J., Preston,R., Vil,D.,
Shekher,M., Matero,A., Shah,R., Swaby,I.K., O'Shaughnessy,A.,
Rodriguez,M., Hoffmann,J., Till,S., Granat,S., Shohdy,N.,
Hasegawa,A., Hameed,A., Lodhi,M., Johnson,A., Chen,E., Marra,M.,
Martienssen,R. and McCombie,W.R.
TITLE Sequence and analysis of chromosome 4 of the plant Arabidopsis
thaliana
JOURNAL Nature 402 (6763), 769-777 (1999)
PUBMED 10617198
REFERENCE 2 (bases 1 to 1055)
CONSRTM NCBI Genome Project
TITLE Direct Submission
JOURNAL Submitted (19-OCT-2022) National Center for Biotechnology
Information, NIH, Bethesda, MD 20894, USA
REFERENCE 3 (bases 1 to 1055)
AUTHORS Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
Vaughn,M. and Town,C.D.
TITLE Direct Submission
JOURNAL Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute,
9704 Medical Center Dr, Rockville, MD 20850, USA
REMARK Protein update by submitter
REFERENCE 4 (bases 1 to 1055)
AUTHORS Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E.
CONSRTM TAIR
TITLE Direct Submission
JOURNAL Submitted (18-FEB-2011) Department of Plant Biology, Carnegie
Institution, 260 Panama Street, Stanford, CA, USA
COMMENT REVIEWED REFSEQ: This record has been curated by TAIR and Araport.
This record is derived from an annotated genomic sequence
(NC_003075).
On Sep 12, 2016 this sequence version replaced NM_116532.2.
FEATURES Location/Qualifiers
source 1..1055
/organism="Arabidopsis thaliana"
/mol_type="mRNA"
/db_xref="taxon:3702"
/chromosome="4"
/ecotype="Columbia"
gene 1..1055
/gene="ABP1"
/locus_tag="AT4G02980"
/gene_synonym="ABP; AT-ERABP1; endoplasmic reticulum auxin
binding protein 1; T4I9.14; T4I9_14"
/note="Auxin binding protein involved in cell elongation
and cell division. ABP1 is ubiquitinated in vitro and in
planta by AtRma2."
/db_xref="Araport:AT4G02980"
/db_xref="GeneID:828120"
/db_xref="TAIR:AT4G02980"
CDS 160..756
/gene="ABP1"
/locus_tag="AT4G02980"
/gene_synonym="ABP; AT-ERABP1; endoplasmic reticulum auxin
binding protein 1; T4I9.14; T4I9_14"
/inference="Similar to RNA sequence,
EST:INSD:EL132735.1,INSD:ES058604.1,INSD:DR237539.1,
INSD:DR237540.1,INSD:DR237534.1,INSD:DR237532.1,
INSD:DR377148.1,INSD:AI999148.1,INSD:AV822080.1,
INSD:ES198127.1,INSD:DR202912.1,INSD:DR237529.1,
INSD:DR237526.1,INSD:DR375275.1,INSD:ES058936.1,
INSD:BP656634.1,INSD:DR237537.1,INSD:EL140402.1,
INSD:DR378703.1,INSD:DR237527.1,INSD:DR237531.1,
INSD:AV782715.1,INSD:BP814675.1,INSD:EH936821.1,
INSD:EL038128.1,INSD:BP600783.1,INSD:DR237538.1,
INSD:BP815740.1,INSD:DR202913.1,INSD:DR202909.1,
INSD:EH898980.1,INSD:EL000984.1,INSD:EL185126.1"
/inference="Similar to RNA sequence,
mRNA:INSD:AY087315.1,INSD:AY093754.1,INSD:AF389278.1,
INSD:S40550.1"
/note="endoplasmic reticulum auxin binding protein 1
(ABP1); FUNCTIONS IN: auxin binding; INVOLVED IN: positive
regulation of cell division, positive regulation of cell
size, unidimensional cell growth, positive regulation of
DNA endoreduplication, cytokinesis; LOCATED IN:
endomembrane system, endoplasmic reticulum lumen;
EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13
growth stages; CONTAINS InterPro DOMAIN/s: Auxin-binding
protein (InterPro:IPR000526), Cupin, RmlC-type
(InterPro:IPR011051), RmlC-like jelly roll fold
(InterPro:IPR014710); Has 186 Blast hits to 186 proteins
in 64 species: Archae - 10; Bacteria - 50; Metazoa - 0;
Fungi - 0; Plants - 107; Viruses - 0; Other Eukaryotes -
19 (source: NCBI BLink)."
/codon_start=1
/product="endoplasmic reticulum auxin binding protein 1"
/protein_id="NP_192207.1"
/db_xref="GeneID:828120"
/db_xref="TAIR:AT4G02980"
/db_xref="Araport:AT4G02980"
/translation="
MIVLSVGSASSSPIVVVFSVALLLFYFSETSLGAPCPINGLPIVRNISDLPQDNYGRPGLSHMTVAGSVLHGMKEVEIWLQTFAPGSETPIHRHSCEEVFVVLKGSGTLYLAETHGNFPGKPIEFPIFANSTIHIPINDAHQVKNTGHEDLQVLVIISRPPIKIFIYEDWFMPHTAARLKFPYYWDEQCIQESQKDEL"
misc_feature 265..753
/gene="ABP1"
/locus_tag="AT4G02980"
/gene_synonym="ABP; AT-ERABP1; endoplasmic reticulum auxin
binding protein 1; T4I9.14; T4I9_14"
/note="Auxin binding protein; Region: Auxin_BP; pfam02041"
/db_xref="CDD:396569"
misc_feature order(286..300,352..354,376..387,391..393,448..450,
454..456,460..462,484..486,490..492,532..534,538..543,
547..561,619..621,625..627,631..636)
/gene="ABP1"
/locus_tag="AT4G02980"
/gene_synonym="ABP; AT-ERABP1; endoplasmic reticulum auxin
binding protein 1; T4I9.14; T4I9_14"
/note="homodimer interface [polypeptide binding]; other
site"
/db_xref="CDD:380349"
misc_feature order(337..339,394..396,400..402,424..429,433..435,
439..441,451..453,457..459,580..582,712..714)
/gene="ABP1"
/locus_tag="AT4G02980"
/gene_synonym="ABP; AT-ERABP1; endoplasmic reticulum auxin
binding protein 1; T4I9.14; T4I9_14"
/note="active site"
/db_xref="CDD:380349"
ORIGIN
tcgaaaatgaaaaatagtattttctgactcttttttatagtatcgggtttaattcagaaatatataaagctttggggtctgtttcgaagtatctttactcttttaacagttctgagacttctaaagagaggaaaattagttcgtcgaagcatcgagaaaatgatcgtactttctgttggttccgcttcttcatctccgatcgtcgtcgtcttttccgtcgcgcttcttctgttctacttctctgaaacttctctaggagctccttgtcccatcaatggcttgccaatcgtgaggaatattagtgaccttcctcaggataactatggaagaccaggtctttcccacatgactgttgctggctccgtattgcatggaatgaaagaggttgaaatatggcttcagacatttgctccaggttcagagacaccaattcacaggcactcctgtgaagaggtttttgttgtcctaaagggcagtggtactctgtatctcgctgaaacacatggaaatttccctgggaaaccaatcgaatttccaatctttgccaacagtacaattcatattccgatcaatgatgctcatcaggtcaaaaacaccggtcatgaggacctgcaggtgttggttatcatatctcggccgcctattaaaatcttcatctacgaagactggtttatgccacacactgctgcaaggctgaagttcccttactattgggatgagcaatgcattcaagaatcacaaaaagacgagctttaaagcaaagtccgaggctaaaagcaagcacaacctttagatagtaaaatcatagttgaggttttgtgacactacgtagatactggtaaattggcaaggattttacatgaatgttgttgttaccagaaagtaaataaatgttcaatctttgatgttcttaagtaagtgagtcctattggtcatgaaaatatgtaagtgtgcacatcttgattgcatttgcgataaatttatagagtttcactcacttttattttcctcttctatattcaaatcatagctcttcgaagacaagaggacatcag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]