GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-06 03:31:41, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_006333008             304 bp    RNA     linear   PLN 28-SEP-2021
DEFINITION  PREDICTED: Telopea speciosissima uncharacterized LOC122662367
            (LOC122662367), ncRNA.
ACCESSION   XR_006333008
VERSION     XR_006333008.1
DBLINK      BioProject: PRJNA765358
KEYWORDS    RefSeq.
SOURCE      Telopea speciosissima
  ORGANISM  Telopea speciosissima
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Proteales; Proteaceae; Telopea.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_057920.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Telopea speciosissima Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..304
                     /organism="Telopea speciosissima"
                     /mol_type="transcribed RNA"
                     /isolate="NSW1024214"
                     /db_xref="taxon:54955"
                     /chromosome="5"
                     /tissue_type="leaf"
                     /dev_stage="Mature"
                     /ecotype="Mountain lineage"
                     /country="Australia: Blue Mountains Botanic Garden, Mount
                     Tomah, NSW"
                     /lat_lon="33.53211 S 150.41949 E"
                     /collection_date="2019-05-30"
     gene            1..304
                     /gene="LOC122662367"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 20 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:122662367"
     ncRNA           1..304
                     /ncRNA_class="lncRNA"
                     /gene="LOC122662367"
                     /product="uncharacterized LOC122662367"
                     /db_xref="GeneID:122662367"
ORIGIN      
acagaacaaactcactcttactgaaaatcaagtttcgggggtgaatgtcttctcgcaaggtttctctggaaatcattttaaggggaaatcttctttccagaaacctgcttatagtttcctagagtccgtgctgccggggaaatcatcttcagcaaaaaccagttatttgcagggaagagagtggaaatgatatacgtggacatcttcaatctcttcttgtactaaatgtttctcaacaagagagacatgtgctgtaagcctgtaactgcgaagaattagatctcgaagggatctatttcgtttt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]