GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-24 09:54:07, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_006126834             348 bp    RNA     linear   PLN 19-JUL-2021
DEFINITION  PREDICTED: Zingiber officinale uncharacterized LOC122034943
            (LOC122034943), transcript variant X3, ncRNA.
ACCESSION   XR_006126834
VERSION     XR_006126834.1
DBLINK      BioProject: PRJNA736965
KEYWORDS    RefSeq.
SOURCE      Zingiber officinale
  ORGANISM  Zingiber officinale
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Liliopsida; Zingiberales;
            Zingiberaceae; Zingiber.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_056007.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Zingiber officinale Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..348
                     /organism="Zingiber officinale"
                     /mol_type="transcribed RNA"
                     /cultivar="Zhangliang"
                     /db_xref="taxon:94328"
                     /chromosome="11B"
                     /tissue_type="rhizome"
                     /country="China: Zhengzhou"
     gene            1..348
                     /gene="LOC122034943"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 7 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:122034943"
     ncRNA           1..348
                     /ncRNA_class="lncRNA"
                     /gene="LOC122034943"
                     /product="uncharacterized LOC122034943, transcript variant
                     X3"
                     /db_xref="GeneID:122034943"
ORIGIN      
ggtgggaatcaagggaaacggcgttggatctgggcatcggcgaccggctgtgtgaggtaacgcccattgtttccttccgatttttcccttgttttgttcgtcggcaagaacaagtcgagccctaacttcgatctcggagagattggtgtcttgtttctggccaccacagctggactagatcaactcctccaccggatctgtgatcgtactctagccaagatcctgagagaagcagagcttgtgttgtgattccggccactacagctctggtggggattgctcttcttcctcagatctgtggtttgctccggcgatcaagaagagattgttaacaccgaatccttatag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]