2024-05-05 21:02:17, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_005818030 369 bp RNA linear VRT 08-APR-2021 DEFINITION PREDICTED: Cygnus olor uncharacterized LOC121066939 (LOC121066939), ncRNA. ACCESSION XR_005818030 VERSION XR_005818030.1 DBLINK BioProject: PRJNA642912 KEYWORDS RefSeq. SOURCE Cygnus olor (mute swan) ORGANISM Cygnus olor Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Anseriformes; Anatidae; Anserinae; Cygnus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_049171.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Cygnus olor Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.6 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..369 /organism="Cygnus olor" /mol_type="transcribed RNA" /isolate="bCygOlo1" /db_xref="taxon:8869" /chromosome="3" /sex="male" /tissue_type="muscle" /dev_stage="adult" /country="Germany: Mainau" /lat_lon="50.149850 N 11.063270 E" /collection_date="2015-07-01" /collected_by="Robert Kraus" gene 1..369 /gene="LOC121066939" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:121066939" ncRNA 1..369 /ncRNA_class="lncRNA" /gene="LOC121066939" /product="uncharacterized LOC121066939" /db_xref="GeneID:121066939" ORIGIN
agacacacctgatgatttattattttcagtagcttatttgtgaatatgaaaaaatgtctttcttgatattcaccaaatgatataaatgcctttactctccagctcttcattttttctgctcactggtgctttgaatgcagtggaaaggcatttctggtctccatggcttctcttaaatgcacgcagagaagggaacataatagagatgatgagccctagcaaattagccaactgcaatctcttcttgttcagttaacgcgcctgtacagccagataccagccacgggagcaaagggctgtgagaggagatttggagcccaagtataggagtagagaagctctcagctgtttgtagcatgtctagaagca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]