GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-25 13:12:51, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_003985618             317 bp    RNA     linear   VRT 18-AUG-2019
DEFINITION  PREDICTED: Sparus aurata uncharacterized LOC115589880
            (LOC115589880), ncRNA.
ACCESSION   XR_003985618
VERSION     XR_003985618.1
DBLINK      BioProject: PRJNA558036
KEYWORDS    RefSeq.
SOURCE      Sparus aurata (gilthead seabream)
  ORGANISM  Sparus aurata
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Eupercaria; Spariformes; Sparidae; Sparus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044196.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Sparus aurata Annotation Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..317
                     /organism="Sparus aurata"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:8175"
                     /chromosome="10"
     gene            1..317
                     /gene="LOC115589880"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 4 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:115589880"
     ncRNA           1..317
                     /ncRNA_class="lncRNA"
                     /gene="LOC115589880"
                     /product="uncharacterized LOC115589880"
                     /db_xref="GeneID:115589880"
ORIGIN      
cggtcatcctcaaccacaaccagcaagtgatggtgctataattggccttgcagctttcattgctacgactgctgtcattggatttgctatattctggtgcctgtatggggcagaacactagattacaattttcttctgtcttaattttccaactcaggttttatgcctttgtagatgcaatagttggctcttgttttcaatctgtctgccccattctggccaacgcaatatctcagcgacaccttgagggaatttctcttggcaccatggatgtgctgattaaagttattggtcaaaggtcactgtgacctcacaat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]