LOCUS       XR_003582754             399 bp    RNA     linear   ROD 21-MAY-2020
DEFINITION  PREDICTED: Marmota flaviventris uncharacterized LOC114092506
            (LOC114092506), ncRNA.
ACCESSION   XR_003582754
VERSION     XR_003582754.1
DBLINK      BioProject: PRJNA516936
KEYWORDS    RefSeq.
SOURCE      Marmota flaviventris (yellow-bellied marmot)
  ORGANISM  Marmota flaviventris
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia;
            Sciuromorpha; Sciuridae; Xerinae; Marmotini; Marmota.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_023144746.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Marmota flaviventris Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..399
                     /organism="Marmota flaviventris"
                     /mol_type="transcribed RNA"
                     /isolate="SJ_83"
                     /db_xref="taxon:93162"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="blood"
                     /dev_stage="adult"
     gene            1..399
                     /gene="LOC114092506"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 1 sample
                     with support for all annotated introns"
                     /db_xref="GeneID:114092506"
     ncRNA           1..399
                     /ncRNA_class="lncRNA"
                     /gene="LOC114092506"
                     /product="uncharacterized LOC114092506"
                     /db_xref="GeneID:114092506"
ORIGIN      

gggagggcgggctgaggtgggcggccagtcgacctttacctttcttggctcgtcctgttggggcatgcttttcctgctggtcaggaggagacgggggctaaaaaacctgacaattctccatggactgaagttttgacttggcatgagggcttcctatggaaaagaggcttgctgagtttgaagcttggagcttgaagagcatggcaccaacatctgttcaggacctccttgctgttcacaatatggcatcatggctagcacatgaaagaaattgttggcctgtatttaatcaaaaagaagggctaagaagaaccttcacatgcagttcacatcaaccctggggcaactgaaaggtcaggatgacctattatggcagagaaaaggaaaaaattaatggga

//