2024-04-26 16:32:36, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_002397038 526 bp RNA linear ROD 23-MAY-2017 DEFINITION PREDICTED: Heterocephalus glaber uncharacterized LOC110350447 (LOC110350447), ncRNA. ACCESSION XR_002397038 VERSION XR_002397038.1 DBLINK BioProject: PRJNA197330 KEYWORDS RefSeq. SOURCE Heterocephalus glaber (naked mole-rat) ORGANISM Heterocephalus glaber Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Hystricomorpha; Bathyergidae; Heterocephalus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_004624764.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Heterocephalus glaber Annotation Release 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..526 /organism="Heterocephalus glaber" /mol_type="transcribed RNA" /isolate="NMR 29" /db_xref="taxon:10181" /chromosome="Unknown" /sex="female" gene 1..526 /gene="LOC110350447" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:110350447" ncRNA 1..526 /ncRNA_class="lncRNA" /gene="LOC110350447" /product="uncharacterized LOC110350447" /db_xref="GeneID:110350447" ORIGIN
gtatgtcaccatatagggaaatccccattgaggtcactatgacctggggacttggggccatcaccttggtcactttctaatacctgccacaggcctaaacactcacccttgccatgtgatgtttcgatgatccagtctacaaataattgaagagacattgatcccttaaattgaggggatgaatgcagaagatgatgacagagtgagtgtgagcatgagatgttattttacttcaagttcatggtcaaatactgtccccagagtacccctcatggggccactcagctacacacagagaaagctgtgagagttgtcaggcctgagccagaggcatcagcccagcccgcttcctctcagctacaacaggaaatgagtgtccaggactctgctctgctaggggactacatgtgctctgtcttctgcaattacccagtcttgagcacagcacttggcacacagccgtccctctacgactactgactggatgaataaatgaatgagcaaaaggacagatgaatgcagccca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]