ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-11-02 18:05:27, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XM_068673829 1807 bp mRNA linear VRT 22-SEP-2024 DEFINITION PREDICTED: Anas acuta vimentin (VIM), mRNA. ACCESSION XM_068673829 VERSION XM_068673829.1 DBLINK BioProject: PRJNA1122813 KEYWORDS RefSeq. SOURCE Anas acuta (northern pintail) ORGANISM Anas acuta Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Anseriformes; Anatidae; Anatinae; Anas. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_088980) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_963932015.1-RS_2024_09 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 09/19/2024 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1807 /organism="Anas acuta" /mol_type="mRNA" /db_xref="taxon:28680" /chromosome="2" gene 1..1807 /gene="VIM" /note="vimentin; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 Proteins" /db_xref="GeneID:137852266" CDS 101..1483 /gene="VIM" /codon_start=1 /product="vimentin" /protein_id="XP_068529930.1" /db_xref="GeneID:137852266" /translation="
MSMSSKNSSYRRMFGGGSRPSTSSRYVVSSSSRYSLGSSLRPSSARFVSASPGGIYATKATSVRLRSSMPPMRLHDAVDFTLADAINSEFKANRTNEKVELQELNDRFANYIDKVRFLEQQNKILLAELEQLKGKGTSRLGDLYEEEMRELRRQVDQLTNDKARVEVERDNLADDITRLREKLQEEMLQREEAENTLQSFRQDVDNASLARLDLERKVESLQEEIVFLKKLHDEEIRELQAQLQEQHIQIDMDVSKPDLTAALRDVRQQYESVAAKNLQEAEEWYKSKFADLSEAANRNNDALRQAKQEANEYRRQIQSLTCEVDALKGSNESLERQMREMEENFALEAANYQDTIGRLQDEIQNMKEEMARHLREYQDLLNVKMALDIEIATYRKLLEGEESRINMPIPTFASLNLRETNIESQPMVDTHSKRTLLIKTVETRDGQVINETSQHHDDLE"
misc_feature 122..385
/gene="VIM"
/note="Intermediate filament head (DNA binding) region;
Region: Filament_head; pfam04732"
/db_xref="CDD:461414"
misc_feature 386..1312
/gene="VIM"
/note="Intermediate filament protein; Region: Filament;
pfam00038"
/db_xref="CDD:459643"
polyA_site 1807
/gene="VIM"
/experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN
gggggccgccgcccttctcctcagagcctcgccgcgcctcagctccccgccggattacaaagcccgcttcgtctccttctcctccttctccgccgccaccatgagcatgagcagcaagaactcctcgtaccgccgcatgttcggcgggggcagccggcccagcacgtcgagccgctacgtggtgagcagcagcagccgctactcgctgggcagctcgctgcgccccagctccgcacgcttcgtctccgcctcgcccggcggcatctacgccaccaaggccacctcggtgcggctgcggagcagcatgccccccatgcggctccacgacgccgtggacttcacgctggccgacgccatcaactcggagttcaaggcgaaccgcaccaacgagaaggtggagctgcaggagctcaacgaccgcttcgccaactacatcgacaaggtgcgcttcctggagcagcagaacaagatcctgctggccgagctggagcagctcaagggcaagggcacgtcccgcctgggcgacctgtacgaggaggagatgcgggagctgcgccggcaggtggaccagctcaccaacgacaaggcgagggtggaggtggagcgggacaacctggccgacgacatcacgaggctgagggagaagttgcaggaggagatgctgcagcgggaggaggcggagaacaccctgcagtccttcaggcaggatgttgacaatgcctctctggcacgccttgatcttgagcgcaaagttgagtccctgcaagaagagattgtcttcttgaagaagcttcatgatgaggaaatccgagaactgcaggcccaactccaggaacagcacatccagatcgatatggatgtttccaagcctgatcttactgctgccctgcgtgatgttcgccaacagtacgaaagcgttgctgctaagaatcttcaggaagctgaagagtggtacaagtccaaatttgcagatctctctgaagctgctaacaggaacaatgatgccctgcgtcaggccaaacaagaagctaatgaataccgcagacagattcagtctctcacctgcgaagttgatgcccttaaaggaagcaatgaatccctggagcgccagatgcgtgaaatggaggagaattttgctcttgaagctgctaactaccaagacactattggccgtctgcaggatgagattcagaacatgaaggaagaaatggctcgccatcttcgtgagtaccaggacctgctgaatgtaaagatggctcttgatattgagattgccacctacagaaaactgctggagggagaagagagcaggattaacatgcctattccaacctttgcttctttgaacctgagagaaaccaacattgagtctcagccaatggttgacactcactcaaagaggacacttctaattaagactgtggaaactagagatggacaggttattaatgaaacttcccagcaccatgatgacttggagtaaagctgaagtgaagatgcaaacttaatgcaggagaaattcttaccagcaaggtttaaaaaagtccatgtcttaaaggaagaaacagctttcaagtgcctttctgcagtttttccatgagcgcaagattattatgctaggaaataggtcttagatcttgcaaactgactctccctgaaggattagagtttacaatggagtctagtttacaaatagcaatatcttgtgctgcaatactgtttttaagtatctgaattcaataaaactgctttttccagcacagtatgagcaacctgtcgctacttcaataaatctttggaaaatggc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]