2025-07-07 06:44:34, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XM_067255313 2970 bp mRNA linear VRT 13-AUG-2024 DEFINITION PREDICTED: Osmerus mordax argonaute RISC component 4 (ago4), transcript variant X7, mRNA. ACCESSION XM_067255313 VERSION XM_067255313.1 DBLINK BioProject: PRJNA1145451 KEYWORDS RefSeq. SOURCE Osmerus mordax (rainbow smelt) ORGANISM Osmerus mordax Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Stomiati; Osmeriformes; Osmeridae; Osmerus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_090067) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_038355195.1-RS_2024_08 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 08/12/2024 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2970 /organism="Osmerus mordax" /mol_type="mRNA" /isolate="fOsmMor3" /db_xref="taxon:8014" /chromosome="18" /sex="male" /tissue_type="muscle, testes, liver, kidney, brain, misc" /dev_stage="adult" /geo_loc_name="Canada: Placentia Bay Newfoundland" /lat_lon="47.431645 N 53.826133 W" /collection_date="2019-10-17" /collected_by="Amber Messmer" gene 1..2970 /gene="ago4" /note="argonaute RISC component 4; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 3 Proteins" /db_xref="GeneID:136961841" CDS 232..2490 /gene="ago4" /codon_start=1 /product="protein argonaute-4 isoform X7" /protein_id="XP_067111414.1" /db_xref="GeneID:136961841" /translation="
MLLDALSGHLNEVPEDSVQALDVITRHLPSMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWNMMLNIDVSATAFYRAQPVIEFMCEVLDIQNINEQTKPLTDSQRVKFTKEIRGGWGPAGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLENGQAMECTVAQYFKQKYSLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVKSNSMVGGPDPYLKEFGIVVHNDMTEVTGRVLPAPMLQYGGRVSTDTGRDCGRGLSPQNKTVATPNQGVWDMRGKQFYAGIEIKVWAVACFAPQKQCREDLLKSFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFKHLKMSYVGLQLIVVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINAKLGGINNVLVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDGHPSRYCATVRVQTSRQDLSQEQLYSQEVIQDLTNMVRELLIQFYKSTRFKPTRIIYYRGGVSEGQMKQVAWPELIAIRKACISLEEDYRPGITYIVVQKRHHTRLFCSDKAERVGKSGNVPAGTTVDSTITHPSEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKDHDSAEGSHVSGQSNGRDPQALAKAVQIHYDTQHTMYFA"
misc_feature 334..486 /gene="ago4" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:462567" misc_feature 487..867 /gene="ago4" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(661..663,706..708,748..750,760..762,814..816, 835..837,841..843) /gene="ago4" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1006..2361 /gene="ago4" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1465..1467,1477..1479,1513..1524,1531..1533, 1555..1557,1564..1566,1576..1578,1588..1590) /gene="ago4" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(1669..1671,1675..1677,1915..1917,2329..2331) /gene="ago4" /note="active site" /db_xref="CDD:240015" ORIGIN
aatgtttaaacagaagctgactgtgcccctacattttttcacttgggggcacatgtgctccagcaaaaaaaagttggcgtagagccctgaaggaggaaccaatttcacacttgaaatcctgtcctagtttgggaaaactagtttgtggacctggaagtgaccctccctggggaggggaaggaccagacgttcaaagtgtctctgcagtgggtgtcagtggtgagcctgcagatgctcttggatgccctgtctggacacctgaacgaggtccctgaggactccgtgcaggccctggacgtcatcacacgccacctgccttccatgaggtacaccccagtgggccgctccttcttttcccccccagagggctactaccaccccctgggcggaggccgggaggtgtggttcggcttccaccagtccgtccgtcctgccatgtggaacatgatgctcaacatcgatgtttcagccacagcgttttaccgagcccagccagtcatagagttcatgtgcgaggtcctggatatccaaaacatcaacgagcagacaaagccactcaccgactcccaacgcgtcaagttcaccaaggagatccgaggtgggtggggacctgcaggtctgaaggtagaggtcacacactgtggccagatgaagaggaaataccgtgtgtgcaatgtcacacgtcgccctgccagccaccaaacgttccctctgcagctagagaacggccaagccatggagtgcactgtagcgcagtacttcaagcagaagtacagtctgcagctcaaatacccccacctaccctgtctgcaagtagggcaagaacagaagcacacttatctgcccctggaggtttgtaatattgtggcagggcagcgctgcatcaagaaactaacagacaaccagacgtccaccatgatcaaagccaccgctcgctccgctcccgacagacaggaagaaatcagccgactggtcaaaagcaacagcatggtgggtggtccggacccctacctgaaggagtttggcatcgtggtccacaacgacatgacggaggtgacaggccgtgtgctcccagcacccatgctgcagtatgggggccgggtcagcaccgacaccggaagggactgtggcaggggactctctccgcagaataagacggtggccacgcccaaccagggcgtgtgggacatgagggggaagcagttctacgccggcatcgagatcaaggtgtgggctgtggcctgcttcgccccgcagaaacagtgcagagaagacctgctcaagagtttcacagatcagctgcgtaagatctctaaggacgctggcatgcccatccagggccagccctgcttctgcaagtatgcccagggggcagacagcgtggagcccatgttcaaacacctcaagatgtcctatgttggcctacagctcattgtggtcatcctgcccggcaaaacgcctgtctacgcggaggtgaagcgtgtaggagacactctgctgggcatggccacccagtgtgtccaggtgaagaatgtggtgaagacctccccccagaccctctccaacctctgcctcaagatcaacgccaaactggggggcatcaacaacgtcctcgttccccatcagaggccctccgtgttccagcagcccgtcatcttcctgggcgctgacgttacccaccccccggcgggtgacggtaagaagccgtccatcgcagcggtggtgggcagcatggatggccatcccagccgctactgtgccaccgtgcgggtgcaaacctcccgccaggacctgtcccaggagcagctttacagccaggaagtgatccaggacctgaccaacatggtgagagagctgctcattcagttctacaagtccacccgcttcaagcccacacggatcatttactaccgaggaggagtgtcggagggccagatgaaacaggtggcttggccagagctgatagccatcaggaaggcgtgtatcagtctggaggaggactacagaccgggcatcacctacatcgtggtgcagaaacgccaccacacccgcctcttctgctccgacaaggctgagagagtgggcaagagtggcaacgttccggccggcaccacagtggacagcaccatcacacatccctctgagtttgacttctacctgtgcagccatgctgggatccagggcaccagtcggccctcccactaccacgtcctgtgggacgacaactgcttcacggcagacgagctccagctgctgacctaccagctgtgccacacctacgtccgctgcacacgctccgtctccatccctgcgccagcctactacgcccgcctggtggccttccgcgcccgctaccacctggtggacaaagaccacgacagtgcggagggcagccatgtgtcagggcagagtaacggccgggatccccaggccctggccaaggctgtccagattcactatgacacccagcacaccatgtacttcgcttgaaccacaccagcagggacagcgcaacttcctctctatcctctctctctctgtctctgtttttttgccagtctctctctctctctcttccttgcgtcttgatctgcacctgagcgacgagaagccagtggaattcggcctcgttgtcctccccacttcccactcgggggtgggaaacaaacaacgtttggcgttcccacaatcaagtcgccttctaccagcaaaagcaggcagtacaggacccgcctgggtcgccactgcgcagagtaaaatccccacacttacacagttgagccatttctattgagttatcgatcatttatttcggttttgaatgtctatttttgtttgtttttgtaatatacactgagcgcggggcggactggcgctaaccgccagggcagctctttagctctcccagctaagcaggactctactttacctcaaagcccttttggggcgaaatctgtcacaaggtcttgg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]