2024-11-03 22:29:00, GGRNA.v2 : RefSeq release 226 (Sep, 2024)
LOCUS XM_066225539 447 bp mRNA linear PLN 02-JUL-2024 DEFINITION Kwoniella europaea PYCC6329 uncharacterized protein (V865_001725), partial mRNA. ACCESSION XM_066225539 VERSION XM_066225539.1 DBLINK BioProject: PRJNA1105968 BioSample: SAMN02412473 KEYWORDS RefSeq. SOURCE Kwoniella europaea PYCC6329 ORGANISM Kwoniella europaea PYCC6329 Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina; Tremellomycetes; Tremellales; Cryptococcaceae; Kwoniella. REFERENCE 1 (bases 1 to 447) AUTHORS Coelho,M.A., David-Palma,M., Shea,T., Bowers,K., McGinley-Smith,S., Mohammad,A.W., Gnirke,A., Yurkov,A.M., Nowrousian,M., Sun,S., Cuomo,C.A. and Heitman,J. TITLE Comparative genomics of Cryptococcus and Kwoniella reveals pathogenesis evolution and contrasting modes of karyotype evolution via chromosome fusion or intercentromeric recombination JOURNAL Unpublished REFERENCE 2 (bases 1 to 447) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (27-JUN-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 447) AUTHORS Coelho,M.A., David-Palma,M., Shea,T., Sun,S., Cuomo,C.A. and Heitman,J. TITLE Direct Submission JOURNAL Submitted (31-JAN-2024) Department of Molecular Genetics and Microbiology, Duke University, DUMC Box 3546, 317 CARL Building, Durham, NORTH CAROLINA 27710, USA COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NC_089487). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..447 /organism="Kwoniella europaea PYCC6329" /mol_type="mRNA" /strain="PYCC6329" /db_xref="taxon:1423913" /chromosome="1" gene <1..>447 /locus_tag="V865_001725" /db_xref="GeneID:91100529" CDS 1..447 /locus_tag="V865_001725" /codon_start=1 /product="uncharacterized protein" /protein_id="XP_066081636.1" /db_xref="GeneID:91100529" /translation="
MSHSNADIPLVEIISEPYTSTNPPQYARQDSQQLSTTSTASGEQSHATHNTQSQNTTGQSNSTDPPRSSPTLERTLSEATTVVDVGAGQSHIDLPSFTVRTTGQSCCETHSGEIAKCMCYSVTCVCGAGLAIGTVAAISSCCNGCPPF"
ORIGIN
atgagtcattcgaatgcggatatccctctagtggaaatcataagcgaaccatatacttccacgaatccacctcaatatgcccgccaagattcacaacaactatccacaacgtctacagcgagtggcgaacaatctcatgccacccataatactcaaagtcaaaatacgactggtcaatccaattcgaccgatccacctcggagctcacctactctggaacgtaccctctctgaggcgactactgtcgtggatgtaggtgccggtcaatctcatatcgacctacccagcttcacggtccgaacaactggtcaatcctgctgcgaaacccattcaggcgagattgcgaaatgtatgtgttatagcgttacgtgcgtttgtggggcgggtttggcgattggtacagtggcggcaatctcttcttgctgtaatggatgccctcccttctaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]