GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-11-23 18:37:42, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       XM_065399721            1815 bp    mRNA    linear   VRT 17-MAY-2024
DEFINITION  PREDICTED: Emys orbicularis vimentin (VIM), mRNA.
ACCESSION   XM_065399721
VERSION     XM_065399721.1
DBLINK      BioProject: PRJNA1107594
KEYWORDS    RefSeq.
SOURCE      Emys orbicularis (European pond turtle)
  ORGANISM  Emys orbicularis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Testudinata; Testudines; Cryptodira; Durocryptodira;
            Testudinoidea; Emydidae; Emys.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_088684) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_028017835.1-RS_2024_05
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 05/09/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1815
                     /organism="Emys orbicularis"
                     /mol_type="mRNA"
                     /isolate="rEmyOrb1"
                     /db_xref="taxon:82168"
                     /chromosome="2"
                     /sex="male"
                     /tissue_type="blood"
                     /dev_stage="adult"
                     /geo_loc_name="Italy: Reserve Naturale Monte Rufeno"
                     /lat_lon="42.78473 N 11.88612 E"
                     /collection_date="2019-08-01"
                     /collected_by="Claudio Ciofi"
     gene            1..1815
                     /gene="VIM"
                     /note="vimentin; Derived by automated computational
                     analysis using gene prediction method: Gnomon. Supporting
                     evidence includes similarity to: 89 Proteins"
                     /db_xref="GeneID:135874789"
     CDS             101..1489
                     /gene="VIM"
                     /codon_start=1
                     /product="vimentin"
                     /protein_id="XP_065255793.1"
                     /db_xref="GeneID:135874789"
                     /translation="
MSTTMSSKSSYRRMFGGGSRPSTSGSRYITSSGRYSLGSAIRPGSSRLVSSSPGGVYATKSSALRLRSSLPPTRFMHDTVDFSLADAINTEFKANRTNEKVELQELNDRFANYIDKVRFLEQQNKILVAELEQLKGKGTSRLGDLYEEEMRELRRQVDQLTNDKARVEVERDNLADDILRLREKLQEEMIQREEAESTLQSFRQDVDNASLARLDLERKVESLQEEIVFLKKLHDEEIRELQVQIQEQHIQIDVDVAKPDLTAALRDVRQQYESVATKNLQEAEEWYKSKFADLSEAATRNNDALRQAKQEANEYRRQIQTLTCEVDALKGTNESLERQMREMEDNFAVEAANYQDTIARLQDEIQNMKEEMARHLHEYQELLNVKMALDIEIATYRKLLEGEESRITMPIPTFASLNLRETNIESHPMVDTLSKRTLLIKTVETRDGQVINETSQHHDDLE"
     polyA_site      1815
                     /gene="VIM"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
accgccgcgggcagctgccgccgctctccttcgcctctctcgctccagcagcagtcaccggacccaccacccctcggattacaaagcgccggccgccgccatgagcaccaccatgagcagcaagagctcgtaccgcaggatgttcggcggcggcagccgccccagcacctcgggcagccgctacatcacctcctccggccgctactcgctgggcagcgccatccgccccggcagcagccgcctggtctcctcctcgcccggcggcgtctatgccaccaagtcctcggccctgcggctgcggagcagcctgccccccacgcggttcatgcacgacaccgtggacttctcgctggccgatgccatcaacacggagttcaaggccaaccgcaccaacgagaaggtggagctgcaggagctgaacgaccgcttcgccaactacatcgacaaggtgcgcttcctggagcagcagaacaagatcctggtggccgagctggagcagctcaagggcaagggcacctcccgcctgggggacctctacgaggaggagatgcgggagctccgccggcaggtggaccagctcaccaacgacaaagccagggtggaggtggagagggacaacctggccgatgacatcctgaggctcagggagaagttgcaagaagagatgattcagcgagaagaagctgaaagcaccctgcaatctttcagacaggatgttgacaatgcctctctggcacgtcttgatcttgagcgcaaagttgagtccttgcaagaagagattgtcttcttgaagaagcttcatgatgaggaaatccgtgaactgcaggtccagattcaggaacaacacatccaaattgatgtggatgttgctaaaccagatctcactgctgccctgcgtgatgtccgtcagcagtatgaaagtgttgctactaagaatcttcaggaagctgaagaatggtacaagtccaagtttgcagatctctctgaagctgctactaggaacaatgatgccctacgtcaggccaaacaggaagctaatgagtaccgtagacaaatacagaccctcacctgcgaagttgatgcacttaaaggaactaatgaatccctggagcgccagatgcgtgaaatggaggacaactttgctgttgaagctgctaactatcaagacactattgcccgtctgcaggatgaaatccaaaacatgaaggaagaaatggctcgccatcttcatgagtaccaagaactgctgaatgtcaagatggctcttgatattgagattgctacatatagaaaactgttggagggagaggagagcagaattaccatgcctattccaacttttgcttccctgaacctgagggaaaccaacattgagtctcaccctatggttgacactctctcaaagaggacactcttaattaagactgttgaaaccagagatggacaggttatcaatgaaacttcccagcatcacgatgatctggagtgaaaaccctagagaaactgcacatttctcacttgtgcagtgaaaagattcttaccagcaaaatttaaaaagtccctgtcttaaaggaagaaacagcttaagtgcctttctgcagtttttccaaaagcgcaagattattatgctagagaataggtattagatcttgcaaactgactctccctgaaggtttagagtttacaatggagtctagtttacagatagcaatatcttgtgctgcaatactgtttaagtttctgaattcaataaaactgctttttccagcaaagtatgagcaatttcactgcttcaataaatatttggaaaatggc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]