GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-12-04 02:39:57, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       XM_057828895            1537 bp    mRNA    linear   VRT 16-MAY-2024
DEFINITION  PREDICTED: Corythoichthys intestinalis claudin-3-like
            (LOC130911141), mRNA.
ACCESSION   XM_057828895
VERSION     XM_057828895.1
DBLINK      BioProject: PRJNA989181
KEYWORDS    RefSeq.
SOURCE      Corythoichthys intestinalis (scribbled pipefish)
  ORGANISM  Corythoichthys intestinalis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Syngnathiaria; Syngnathiformes; Syngnathoidei;
            Syngnathidae; Corythoichthys.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_026651592) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_030265065.1-RS_2024_05
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 05/15/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1537
                     /organism="Corythoichthys intestinalis"
                     /mol_type="mRNA"
                     /isolate="RoL2023-P3"
                     /db_xref="taxon:161448"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="body"
                     /dev_stage="adult"
                     /geo_loc_name="Philippines"
     gene            1..1537
                     /gene="LOC130911141"
                     /note="claudin-3-like; Derived by automated computational
                     analysis using gene prediction method: Gnomon. Supporting
                     evidence includes similarity to: 159 Proteins"
                     /db_xref="GeneID:130911141"
     CDS             78..1289
                     /gene="LOC130911141"
                     /codon_start=1
                     /product="claudin-3-like"
                     /protein_id="XP_057684878.1"
                     /db_xref="GeneID:130911141"
                     /translation="
MVSQGVQMIGISSATVGWFMVIVTCALPMWKVTAFVGANIITAQTIWQGLWMNCVVQSTGQMQCKVYDSMLALERDLQAARAMIIISILLGVFGVAMSVAGGKCTNCIREEVPKARACILAGALFLASGLLCLIPVSWSANAIVSNFYNPLVIPAQRFDLSVMGRIGKETAGQVIGFIGLVGVAVTTGIPMWRVTTFIGANIVTGQIVWDGLWMNCVMQSTGQMQCRLSESVITLTPDLQAARALVIISLVFGFIGFMVTFIGAKCTSCLQQDASKARVVIIGGVLLIIAAVLVLIPVTWSATITITDFQNPLTVDTQRREIGASIYIGWASTALLLVGGIILTTSCPPQTPMYPYAAYPYANGSTYAPVYAPPSSQPYTPSGSYYPAKPYAAPSGYSPRQYI"
     misc_feature    90..530
                     /gene="LOC130911141"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; cl21598"
                     /db_xref="CDD:473919"
     misc_feature    597..1106
                     /gene="LOC130911141"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; cl21598"
                     /db_xref="CDD:473919"
ORIGIN      
ctccgcgtcacggcttttctctcattctgagacaaactcgggagagagctcacgtctttttcacctagccacgcaaaatggtttctcagggcgttcagatgatcggcatatcttcggccaccgtcggctggttcatggtgattgtgacgtgtgctttgcccatgtggaaggtgacggccttcgtaggggccaacatcattacggcgcagaccatctggcagggattgtggatgaactgcgtggtgcagagtacgggacagatgcagtgcaaggtgtacgactccatgctggcgctggagcgagacctgcaggccgcccgcgccatgatcatcatctccatcctgctgggcgttttcggcgtcgccatgtccgtcgcgggcggcaagtgcaccaactgcatccgggaggaagttcccaaagcccgggcgtgcatcttggccggcgcactcttcctggcgtccggccttttgtgcctgattcccgtgtcgtggtcggccaacgccatcgtcagcaacttctacaacccactggtcatcccggcccagcgcttcgacctctcagtcatggggagaattggcaaggagacggcgggtcaggtcatcggcttcatcggtctggtgggggtggcggtcaccaccggcatccccatgtggagggtgaccaccttcatcggcgccaacatcgtgacgggccagatcgtgtgggacggcctgtggatgaactgcgtcatgcagagcaccggccaaatgcagtgtcgcctcagcgaatctgttataacgttaacccctgatctccaagcggcgcgagcgctagtcatcatctcgctggtttttggattcatcggcttcatggtcacgttcatcggcgccaaatgcaccagctgcctccagcaagacgcctccaaggccagagtggtgatcatcggtggggttttgctcatcatcgctgccgttttagtcctcattccggtcacctggtcggcgaccatcaccatcaccgactttcagaacccgttgaccgtcgacacgcagagacgagagataggagcgtctatctacatcggttgggcgtccaccgccctcctcctggtaggggggatcatcctcaccacttcctgtccaccgcagacgcccatgtacccttacgccgcctacccgtatgctaacggttccacctacgcgccggtttacgcgccgccatccagccagccgtacacgccgagcgggtcgtactatcccgccaaaccgtacgcggcgccatccggatactcgccgagacagtacatttgaaaggactgaatggaactgcattcaaattcacggataatgtgctatggtagttagtaaagcagtaaaacgtgaacgttcactgccagagctagcggttgaaaatgattggaccgtgattgtttcgtcagcatgcgtgtttgcaccggagtttaacattgttgagaattaactccttttttttttaggtttaattgcgctgattttttgtaaataactcaatgtgttaataaataatgaaaaaatactat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]