GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-20 10:40:14, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_042776241            1231 bp    mRNA    linear   VRT 27-JUL-2021
DEFINITION  PREDICTED: Cyprinus carpio triosephosphate isomerase A-like
            (LOC109112142), mRNA.
ACCESSION   XM_042776241
VERSION     XM_042776241.1
DBLINK      BioProject: PRJNA745992
KEYWORDS    RefSeq.
SOURCE      Cyprinus carpio (common carp)
  ORGANISM  Cyprinus carpio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Cyprinidae; Cyprininae; Cyprinus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_056590.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Cyprinus carpio Annotation Release
                                           101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1231
                     /organism="Cyprinus carpio"
                     /mol_type="mRNA"
                     /isolate="SPL01"
                     /db_xref="taxon:7962"
                     /chromosome="A19"
                     /tissue_type="muscle"
                     /dev_stage="adult"
     gene            1..1231
                     /gene="LOC109112142"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 EST, 39 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 125 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:109112142"
     CDS             90..836
                     /gene="LOC109112142"
                     /codon_start=1
                     /product="triosephosphate isomerase A-like"
                     /protein_id="XP_042632175.1"
                     /db_xref="GeneID:109112142"
                     /translation="
MSSRKFFVGGNWKMNGDKESLGEVIMTLNTASLNDETEVVCGAPSIYLDYVRSKLDQRIGVAAQNCYKVPKGAFTGEISPAMIKDCSVDWVILGHSERRHVFGESDELIGQKVAHCLENDLGVIACIGEKLEEREAGTTEDVVFEQTKVIADNVKDWTHVVIAYEPVWAIGTGKTATPDQAQEVHEKLRGWLRANVSDAVADSVRIIYGGSVTGGNCKELAAQPDIDGFLVGGASLKPEFVDIINARA"
     misc_feature    90..827
                     /gene="LOC109112142"
                     /note="triosephosphate isomerase; Provisional; Region:
                     PTZ00333"
                     /db_xref="CDD:240365"
     misc_feature    order(120..122,126..128,372..374,582..584,600..602,
                     720..722,777..779,783..788)
                     /gene="LOC109112142"
                     /note="substrate binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:238190"
     misc_feature    order(120..122,129..131,222..230,234..236,243..245,
                     279..281,333..335,342..347,378..383)
                     /gene="LOC109112142"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:238190"
     misc_feature    order(126..128,372..374,582..584)
                     /gene="LOC109112142"
                     /note="catalytic triad [active]"
                     /db_xref="CDD:238190"
     polyA_site      1231
                     /gene="LOC109112142"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
ccttctccatagtaggattcctaagttctctagcgggagtggatatactgcagtcggtgtgtttggtgaggtcggtttgtctcgcaataatgtcttcaagaaaattcttcgtcgggggaaactggaaaatgaacggcgataaggagagtttgggcgaggtcataatgaccttgaacacggccagtctcaacgatgaaacagaggtggtgtgtggagcaccatccatttatcttgattatgtgaggtctaagctggaccagaggatcggagtggccgcccagaactgctataaggtacccaaaggagccttcaccggggagatcagcccagcgatgattaaagactgcagtgtggactgggtcattctgggccattctgagaggcgtcacgtgtttggcgagagcgatgagctgattggccagaaagtggcccattgcctagagaacgatttgggtgtgattgcctgcattggggagaaactagaggagagagaagctggaaccactgaggatgtggtgtttgaacagactaaagtcattgcagacaatgtgaaggactggactcatgtggttatagcatatgagccagtgtgggccattggcactggcaaaaccgccactcctgatcaggctcaggaggtgcatgagaagctgcgaggatggctgagagcgaatgtgtcggatgcagtagctgactctgtgcgcatcatctacggaggctctgttactgggggaaactgcaaagaacttgcggcccagcctgacattgatggcttcctggttggaggtgcctcccttaagccagagtttgttgacatcataaatgcccgcgcatagagatgctcagccattttgacagtccaaaactgctgcactgcccaatcagtgtataccagcttcttgttgtcattccagcaggtctgaaagtgtatttgtggttgtactgcttttgctcacctgcttgttaaacggtcgggttgggttattggactggaatattaatatcaactcacttcctacttaaagtaatagaagagagcttgggcgtgttagtttgttatttgctgctgcactcgtgttgtctatgcacttccagagcacactgcttgaaatctaacatactgtactctccacattgaatgcttaactgagtttgtagtgacttaatgagctctttatcctctgtagaaatgactacctctgtagaaaattaaaaacatatttgtcctgtc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]