2024-04-20 10:40:14, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_042776241 1231 bp mRNA linear VRT 27-JUL-2021 DEFINITION PREDICTED: Cyprinus carpio triosephosphate isomerase A-like (LOC109112142), mRNA. ACCESSION XM_042776241 VERSION XM_042776241.1 DBLINK BioProject: PRJNA745992 KEYWORDS RefSeq. SOURCE Cyprinus carpio (common carp) ORGANISM Cyprinus carpio Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Cyprinidae; Cyprininae; Cyprinus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_056590.1) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Cyprinus carpio Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1231 /organism="Cyprinus carpio" /mol_type="mRNA" /isolate="SPL01" /db_xref="taxon:7962" /chromosome="A19" /tissue_type="muscle" /dev_stage="adult" gene 1..1231 /gene="LOC109112142" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 EST, 39 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 125 samples with support for all annotated introns" /db_xref="GeneID:109112142" CDS 90..836 /gene="LOC109112142" /codon_start=1 /product="triosephosphate isomerase A-like" /protein_id="XP_042632175.1" /db_xref="GeneID:109112142" /translation="
MSSRKFFVGGNWKMNGDKESLGEVIMTLNTASLNDETEVVCGAPSIYLDYVRSKLDQRIGVAAQNCYKVPKGAFTGEISPAMIKDCSVDWVILGHSERRHVFGESDELIGQKVAHCLENDLGVIACIGEKLEEREAGTTEDVVFEQTKVIADNVKDWTHVVIAYEPVWAIGTGKTATPDQAQEVHEKLRGWLRANVSDAVADSVRIIYGGSVTGGNCKELAAQPDIDGFLVGGASLKPEFVDIINARA"
misc_feature 90..827 /gene="LOC109112142" /note="triosephosphate isomerase; Provisional; Region: PTZ00333" /db_xref="CDD:240365" misc_feature order(120..122,126..128,372..374,582..584,600..602, 720..722,777..779,783..788) /gene="LOC109112142" /note="substrate binding site [chemical binding]; other site" /db_xref="CDD:238190" misc_feature order(120..122,129..131,222..230,234..236,243..245, 279..281,333..335,342..347,378..383) /gene="LOC109112142" /note="dimer interface [polypeptide binding]; other site" /db_xref="CDD:238190" misc_feature order(126..128,372..374,582..584) /gene="LOC109112142" /note="catalytic triad [active]" /db_xref="CDD:238190" polyA_site 1231 /gene="LOC109112142" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
ccttctccatagtaggattcctaagttctctagcgggagtggatatactgcagtcggtgtgtttggtgaggtcggtttgtctcgcaataatgtcttcaagaaaattcttcgtcgggggaaactggaaaatgaacggcgataaggagagtttgggcgaggtcataatgaccttgaacacggccagtctcaacgatgaaacagaggtggtgtgtggagcaccatccatttatcttgattatgtgaggtctaagctggaccagaggatcggagtggccgcccagaactgctataaggtacccaaaggagccttcaccggggagatcagcccagcgatgattaaagactgcagtgtggactgggtcattctgggccattctgagaggcgtcacgtgtttggcgagagcgatgagctgattggccagaaagtggcccattgcctagagaacgatttgggtgtgattgcctgcattggggagaaactagaggagagagaagctggaaccactgaggatgtggtgtttgaacagactaaagtcattgcagacaatgtgaaggactggactcatgtggttatagcatatgagccagtgtgggccattggcactggcaaaaccgccactcctgatcaggctcaggaggtgcatgagaagctgcgaggatggctgagagcgaatgtgtcggatgcagtagctgactctgtgcgcatcatctacggaggctctgttactgggggaaactgcaaagaacttgcggcccagcctgacattgatggcttcctggttggaggtgcctcccttaagccagagtttgttgacatcataaatgcccgcgcatagagatgctcagccattttgacagtccaaaactgctgcactgcccaatcagtgtataccagcttcttgttgtcattccagcaggtctgaaagtgtatttgtggttgtactgcttttgctcacctgcttgttaaacggtcgggttgggttattggactggaatattaatatcaactcacttcctacttaaagtaatagaagagagcttgggcgtgttagtttgttatttgctgctgcactcgtgttgtctatgcacttccagagcacactgcttgaaatctaacatactgtactctccacattgaatgcttaactgagtttgtagtgacttaatgagctctttatcctctgtagaaatgactacctctgtagaaaattaaaaacatatttgtcctgtc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]