LOCUS       XM_041484906             645 bp    mRNA    linear   VRT 06-MAY-2021
DEFINITION  PREDICTED: Pyrgilauda ruficollis claudin 3 (CLDN3), mRNA.
ACCESSION   XM_041484906
VERSION     XM_041484906.1
DBLINK      BioProject: PRJNA703052
KEYWORDS    RefSeq.
SOURCE      Pyrgilauda ruficollis (rufous-necked snowfinch)
  ORGANISM  Pyrgilauda ruficollis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Passeriformes; Passeroidea;
            Passeridae; Pyrgilauda.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_024528710.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Pyrgilauda ruficollis Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.6
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..645
                     /organism="Pyrgilauda ruficollis"
                     /mol_type="mRNA"
                     /isolate="IOZ18807"
                     /db_xref="taxon:221976"
                     /chromosome="Unknown"
                     /sex="pooled male and female"
                     /tissue_type="blood"
                     /altitude="4200 m"
     gene            1..645
                     /gene="CLDN3"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 70 Proteins"
                     /db_xref="GeneID:121362955"
     CDS             1..645
                     /gene="CLDN3"
                     /codon_start=1
                     /product="claudin-3"
                     /protein_id="XP_041340840.1"
                     /db_xref="GeneID:121362955"
                     /translation="

MSMGLEIGGVALSVLGWLCSIICCALPMWKVSAFIGNNIVTAQILWEGLWMNCVVQSTGQMQCKVYDSMLALPQDLQAARALLVVAIILAVLGLMVAIVGAQCTRCVEDESTKAKITIVSGVIFLLSGVMTLIPVCWSANTIIRDFYNPLVIEAQKRELGTSLYVGWAASALLLLGGGLLCCSCPPKDDRYPTGKVAYSAPRSAVTSYDKRNYV"

     misc_feature    7..501
                     /gene="CLDN3"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; cl21598"
                     /db_xref="CDD:451326"
ORIGIN      

atgtcgatggggctggagatcggcggcgtggccttgtccgtgctgggttggctgtgcagcatcatctgctgcgcgttgcccatgtggaaggtgtcggccttcatcggtaacaacatcgtgacggcccagatcctctgggaagggctgtggatgaactgcgtggtgcagagcacggggcagatgcagtgcaaggtctatgactccatgctggcgctccctcaggacctgcaagccgcccgtgccctgctggtggtggccatcatcttggccgtcctgggcttaatggtggccatcgtgggcgcccagtgcacccgctgcgtggaggatgagagcaccaaagccaagatcaccatcgtctccggcgtcatcttcctcctctctggtgtcatgaccctcatccctgtctgctggtcggccaacaccatcatccgggatttctacaacccgctggtgatcgaagcgcagaagcgagagctgggcacctcgctctacgtgggctgggcagcctccgcactcctgctgctgggggggggcctgctctgctgctcctgcccccccaaagacgacaggtaccccacgggcaaggtggcctactctgccccacgctccgccgtcaccagctacgacaagaggaactatgtctga

//