GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-26 20:36:12, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_041303660            2933 bp    mRNA    linear   PLN 15-SEP-2021
DEFINITION  Suillus plorans argonaute-like protein (HD556DRAFT_1394987), mRNA.
ACCESSION   XM_041303660
VERSION     XM_041303660.1
DBLINK      BioProject: PRJNA727287
            BioSample: SAMN14510212
KEYWORDS    RefSeq.
SOURCE      Suillus plorans
  ORGANISM  Suillus plorans
            Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina;
            Agaricomycetes; Agaricomycetidae; Boletales; Suillineae;
            Suillaceae; Suillus.
REFERENCE   1  (bases 1 to 2933)
  AUTHORS   Lofgren,L.A., Nguyen,N.H., Vilgalys,R., Ruytinx,J., Liao,H.L.,
            Branco,S., Kuo,A., LaButti,K., Lipzen,A., Andreopoulos,W.,
            Pangilinan,J., Riley,R., Hundley,H., Na,H., Barry,K.,
            Grigoriev,I.V., Stajich,J.E. and Kennedy,P.G.
  TITLE     Comparative genomics reveals dynamic genome evolution in host
            specialist ectomycorrhizal fungi
  JOURNAL   New Phytol (2020) In press
   PUBMED   33355923
  REMARK    Publication Status: Available-Online prior to print
REFERENCE   2  (bases 1 to 2933)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (15-SEP-2021) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 2933)
  AUTHORS   Kuo,A., Lofgren,L.A., Vilgalys,R., Nguyen,N.H., Ruytinx,J.,
            Liao,H.-L., Branco,S., LaButti,K., Lipzen,A., Andreopoulos,W.,
            Pangilinan,J., Riley,R., Hundley,H., Na,H., Grigoriev,I., Barry,K.,
            Stajich,J.E. and Kennedy,P.G.
  CONSRTM   DOE Joint Genome Institute
  TITLE     Direct Submission
  JOURNAL   Submitted (23-APR-2020) DOE Joint Genome Institute, 2800 Mitchell
            Drive, Walnut Creek, CA 94598-1698, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_024537438).
            
            ##Metadata-START##
            Organism Display Name :: Suillus plorans S12 v1.0
            GOLD Stamp ID         :: Gp0401707
            ##Metadata-END##
FEATURES             Location/Qualifiers
     source          1..2933
                     /organism="Suillus plorans"
                     /mol_type="mRNA"
                     /strain="S12"
                     /db_xref="taxon:116603"
                     /chromosome="Unknown"
                     /country="Austria: Tirol"
     gene            1..2933
                     /locus_tag="HD556DRAFT_1394987"
                     /db_xref="GeneID:64597424"
     CDS             305..2758
                     /locus_tag="HD556DRAFT_1394987"
                     /codon_start=1
                     /product="argonaute-like protein"
                     /protein_id="XP_041157013.1"
                     /db_xref="GeneID:64597424"
                     /db_xref="InterPro:IPR003100"
                     /db_xref="InterPro:IPR003165"
                     /db_xref="InterPro:IPR014811"
                     /db_xref="JGIDB:Suiplo1_1394987"
                     /translation="
MDLIHHLQTIDAVDVFTPRAVYDGRKNLFAPRELPFGPQNSQEFDVCLSDDPNRGSPGENTGGRGPKVYKIRLTKVAQINPEVLQRFILGQQSHDNSVLTALTALNVVVRMEPTMKYPFNVRSFFTDRETKDIGSGLVLWRGYFQSVRPAIGQLLVNVDISTGTMYKSGALMDVCLEFLGRPGQHALLSPRSGLPDRERIRLQRFISGIRVKTTYAGENKTPRVVKKLSSAGAADLSFTLRDGTSRTVAQYFQTILNRPLRFPNNLCIEVGSGALIPVELCTIPPGQIMRKQVPPEKTKDVLEFATKRPEARLASITNGLSVLQYGQSEYVRQFGMHVEDTTGPLTVMARVLQPPKLKYGPGSAQPTITPSNGAWNMIDKRFFRPAAIDRWIVVVYERQQRFNPQAAQDMIDGMLRSFRDVGIRITDDKPMVTWQNGQGRIADQLRAAGTECFQRTKQRPQLIVVVLPENGNDIYTAVKHFGDITVGVATQCLKSQKCFRAKPQYYANVCLKVNVKLGGINTIPDPQSVSVLTDPRNPTIVMGADVIHPAPGSDGRPSFTALVGNVDSDTAKYIATSRVQASRVEIIEDLQDMAKHVLSMYMKYRQFAEKKTGNLAPTRLIFYRDGVSEGQFKQVLDSELKAIKDACAELKINPKITIIVVAKRHHVRFFPSGSGSNEQDKSGNCLAGTVVDQVVAHPTEFDWYLQSHGGLLGTSRPAHYNVLYDENEFSADGLQSLSFALCHVYARSTRSVSIPAPVYYADIVCSRAKNHYDPQGNVDFSDSATQLDTAQAEGALEAYKRGFKPLHANMASLMYFS"
     misc_feature    371..631
                     /locus_tag="HD556DRAFT_1394987"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:435368"
     misc_feature    668..805
                     /locus_tag="HD556DRAFT_1394987"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    806..1153
                     /locus_tag="HD556DRAFT_1394987"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(977..979,1016..1018,1046..1048,1058..1060,
                     1112..1114,1124..1126,1130..1132)
                     /locus_tag="HD556DRAFT_1394987"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1289..2620
                     /locus_tag="HD556DRAFT_1394987"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1727..1729,1739..1741,1775..1786,1793..1795,
                     1817..1819,1826..1828,1838..1840,1850..1852)
                     /locus_tag="HD556DRAFT_1394987"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1937..1939,1943..1945,2177..2179,2588..2590)
                     /locus_tag="HD556DRAFT_1394987"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
gcggcggcggcggcggcggcggcagaggtggtcgtggcggtggtcgcggcggccctcgcggtggaccacctcctcgcggcggcccagctgggggaagaacagttcatgctcccactggtcccgccgctctgcctggaagccatgttcaggccgtgggggtaaaacgacctggatatggaacggcaggcagagcagtgaccgtattctccaacttcttcaagataagtctcccagaaagcgttatccatcactacgacggttggtgatctcgcctgatgagaaggtacttccagcacgcttaaacatggacttgatccatcaccttcaaactatcgatgccgtcgatgtctttacaccccgggccgtctacgatgggcgaaagaacctcttcgcccccagggaactgcctttcggtccacagaacagccaagagtttgatgtatgcctctccgatgaccccaatcgcggaagcccaggagagaacacggggggccgcggtcccaaggtgtacaagatcagactgacgaaagtcgcacaaatcaaccctgaagtcctacaacgctttattcttggacagcagtcacatgacaacagtgttttgaccgccttgacggcattgaatgttgtcgtccgtatggaaccgaccatgaagtacccctttaatgttcggtcattcttcaccgaccgggagactaaggatatcggttccggccttgtcttatggcgtggatacttccaatcagtgaggcccgcaatcggacaactgctcgtgaacgttgatatctcgactggaacgatgtataagtctggagcactgatggatgtctgtctcgagtttttaggtagacctgggcaacacgcgttgctcagcccgcgaagcggtttgcccgatcgtgagcgaatccgcttgcaacgttttatttcaggcatccgagttaaaacaacatacgccggggaaaacaaaaccccccgcgtcgtcaagaaattgagcagcgcaggcgctgcagatttaagtttcaccttgcgggatggaactagtaggaccgtggctcagtatttccaaacgatcctgaaccgtcctctgaggttcccgaataatctttgcattgaggttggcagtggtgccttgatccctgtggaactatgcacgattccaccaggtcaaatcatgcggaagcaggttccacctgagaaaacaaaggacgttctggaattcgctacaaagcgacctgaagcccgcctcgctagtattacaaacggtctttcggtccttcaatatggtcagtcggaatacgtgcgccagttcggcatgcacgtcgaagatactactggaccacttaccgtaatggcgcgggtcttgcaaccgccgaaactgaagtacggcccaggtagtgcacagccgaccattacaccaagtaacggcgcgtggaatatgatcgataaacgattcttcagacctgcagctattgacaggtggatcgtggtagtttacgagaggcagcagcggtttaacccacaggctgcacaagacatgatcgatggcatgttgaggagtttcagagacgttggtatccgtatcaccgacgataagccgatggtaacttggcaaaacggtcaaggccggattgcggaccaactgcgtgccgctggcactgagtgtttccaaaggacgaaacagcgcccacaactcatcgttgtagtgcttcccgagaacggcaatgacatttacactgcggttaaacatttcggggacattacagtcggtgttgcgacccaatgcctaaagagtcagaagtgcttccgtgcaaaaccgcaatattacgcgaacgtctgccttaaggtcaacgttaagctgggtggtatcaatactattccagatcctcagtctgtctctgttcttaccgatcctcgtaaccccaccatcgtcatgggtgccgacgtgattcatcctgcgcctggctctgatgggcgtccttcattcacggcactcgtcggcaacgttgattctgataccgcgaaatacatcgctacaagccgtgttcaagcctctcgggttgagatcatcgaagatctccaggacatggcaaagcacgtcctgagtatgtacatgaagtatcgccagttcgcggagaagaagacggggaatcttgcccccacgcgtctcatcttctacagagatggtgtttctgaaggtcaattcaagcaagttcttgattctgaacttaaggcgatcaaagacgcttgcgcggagttgaagatcaacccaaagatcacaatcatcgtggttgcgaaacgtcaccacgttcgcttcttcccatctggctcagggtcgaatgaacaggataagagcggcaactgcctcgcaggcactgttgtcgaccaggttgttgcccaccccacggaattcgattggtatctgcagagccacggcggtctgctcggtacgagtcgccccgcgcactacaatgttctctacgatgagaacgaatttagcgccgatggtttgcaatctctttctttcgctttgtgccatgtgtatgcacggtcaactcgctctgtttcaatccccgcccctgtgtactatgcagatattgtctgctcacgcgcaaagaatcactacgaccctcaagggaatgttgatttctctgattctgcgacacagctcgacacagctcaggctgagggcgccttggaggcgtacaaacgtggattcaagcccttacatgccaacatggcaagtttgatgtacttctcttgaacactgttgctttacctacttaatcacctcgaagcaaataacggaatcttttcttttctgtgaccgtgtatgatccagttcttctaactagtagtgtctcatgataaccccacctctgtaaaaaatacgtacgttgcacgaataccattgggacctgtattgcttgacgtattat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]