2024-04-27 10:28:21, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_041048366 2085 bp mRNA linear VRT 22-APR-2021 DEFINITION PREDICTED: Toxotes jaculatrix vimentin-related 2 (vimr2), mRNA. ACCESSION XM_041048366 VERSION XM_041048366.1 DBLINK BioProject: PRJNA723051 KEYWORDS RefSeq. SOURCE Toxotes jaculatrix (banded archerfish) ORGANISM Toxotes jaculatrix Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Carangaria; Carangaria incertae sedis; Toxotidae; Toxotes. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_054403.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Toxotes jaculatrix Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.6 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2085 /organism="Toxotes jaculatrix" /mol_type="mRNA" /isolate="fToxJac2" /db_xref="taxon:941984" /chromosome="10" /tissue_type="liver, intestine, and heart used for different sequencing technologies" /dev_stage="adult" /country="Singapore" /lat_lon="1.3521 N 103.8198 E" /collection_date="2019-10-29" /collected_by="Byrappa Venkatesh" gene 1..2085 /gene="vimr2" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 4 Proteins, and 92% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:121188556" CDS 1..1173 /gene="vimr2" /codon_start=1 /product="peripherin" /protein_id="XP_040904300.1" /db_xref="GeneID:121188556" /translation="
MAVLRVSSYRKLFEDDGWSRNGGLGMQCAGQYRASLRGAAVDECDCDKLDFVAAKSLNKESLNRFVQDRTTIAALNDRLVRLIELAHCFERENESLECQIVELEEKLTCQQASSSITSVVAQPDYSLDAVVERLRKQRDEILCDTEELQRELERLKKSYEMAAQQRILFQQERQDVAEEVDAVTAECLALREQVAIYEEQLANMEAQHKAAVESLLEPAEGTRGTVAAIRFSSPDITPALDVKEYYCQLAESLQYECGTASSAVVRSGDGKQLEVGEAAGSRVKDVPKIKDISEMKMLISELQKELAELEKCNEELEDEIEMKKAAYMDEIAELECTVDEMRHQESDLQAQMKEQCADYKELLSEKMARDMEIVAYRSLVEEEEERLCNP"
misc_feature 199..1158 /gene="vimr2" /note="Intermediate filament protein; Region: Filament; pfam00038" /db_xref="CDD:425436" ORIGIN
atggctgtgctcagagtgtcgtcttaccgcaagctgtttgaggatgatggctggagtcgaaatggagggttgggtatgcagtgtgcagggcagtaccgggcctctctcaggggtgcggccgttgacgagtgtgactgtgacaagttagactttgtggctgccaagtctctcaacaaggagagtctcaaccggtttgtccaggaccgcaccaccatcgctgctctcaatgaccgtctggtcaggcttattgaactggcccattgttttgagagggagaatgagtctcttgaatgtcagattgtggagcttgaggagaagctgacctgtcaacaagcctcctccagcatcacctctgttgtggctcaacctgactacagcctggatgcagtggtggaaagactgcgcaagcagagggatgagattctatgtgacactgaggagctgcagagagagcttgaacgtctgaagaaaagctatgagatggctgcacagcagaggatcctgttccagcaagagcgacaagatgttgctgaggaagtggatgctgtgacagcagagtgtttggcactgagggagcaagtggctatctacgaggagcagctggccaacatggaggcccagcacaaggcggcagtggagagtcttctggagccagctgaggggacaagaggaacggtggcagcaattagatttagcagccctgacatcactccggccttggatgtaaaggagtactactgccagctggctgagagcctccagtacgagtgtggcaccgcctcttctgctgtggttcgcagtggtgatggaaaacaactggaagtgggagaagctgcaggctcaagggtcaaagacgtgccaaagataaaggacatcagtgagatgaagatgctgatttcagagctacaaaaggagcttgctgagcttgaaaagtgtaatgaggagctggaggatgagattgagatgaagaaggctgcatacatggatgagattgctgagttggagtgtactgtagatgaaatgcggcaccaggagtctgacctccaagcgcagatgaaggagcagtgtgcagactacaaggagctgctcagtgagaagatggccagagacatggagattgttgcctacaggagtctggtggaggaagaggaagagaggctgtgcaacccgtgaaacgaggccaaagagtcagactggccgtctgcagttcggctggatgctccgtcacacatggattagaaaacagacaaaagaaaatcgtgaaaagcagacccaaatcaagattaaggtaccaacgcagcaatttgagctgatgtaaacttatcatgacagattaatgctgtctggaggcctaagccaggcaattgataacaggtcgcggacagatgaccccgagactccaagaaagatggagctgtctaaaactgggagggaggtgggaggatgggggctctgcagtgagtgtgtatccattcagtgtctggcagtgatatttccttaagtgggttttatctttaccagctcactgatatgattcataaatgttttgtcccctctttgtcgaacaagtctgacacacaaacacacatgccgacacgcacgcaagctaaactgtgcggctccgtggagtcattccccctctgatgccacctcgtccatcacttaaactttgtctgattacgagctcttaacccttgaccccgtcactgttaacaaacatattgacagctccctctcttcagcaacttaaagcgtctcatcgtcgttttgcttttacagtcatgtgtttatgttggttttacatataactgtttgcttttcaaatggttcgtgaagttgtttttctgcagctcttacaaatcgagcacctggatctttccacaaggaaagcctgtgtgattcgttattccttctttgaagagcaatgtcccaatttgctgtcatttcagaaataagcatttggtaatacattccttagtaatcttttccttattttctacaagctgcctgtgataaatcatttttggttcctgcttctgcacaagcgtcagaatgtgctttagatttaaattgaataaaactagt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]