LOCUS       XM_040760502            3315 bp    mRNA    linear   PLN 20-APR-2021
DEFINITION  Sporothrix brasiliensis 5110 RNA interference and protein silencing
            protein (SPBR_02199), partial mRNA.
ACCESSION   XM_040760502
VERSION     XM_040760502.1
DBLINK      BioProject: PRJNA721989
            BioSample: SAMN03201250
KEYWORDS    RefSeq.
SOURCE      Sporothrix brasiliensis 5110
  ORGANISM  Sporothrix brasiliensis 5110
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Sordariomycetes; Sordariomycetidae; Ophiostomatales;
            Ophiostomataceae; Sporothrix.
REFERENCE   1  (bases 1 to 3315)
  AUTHORS   Teixeira,M.M., de Almeida,L.G., Kubitschek-Barreira,P., Alves,F.L.,
            Kioshima,E.S., Abadio,A.K., Fernandes,L., Derengowski,L.S.,
            Ferreira,K.S., Souza,R.C., Ruiz,J.C., de Andrade,N.C., Paes,H.C.,
            Nicola,A.M., Albuquerque,P., Gerber,A.L., Martins,V.P.,
            Peconick,L.D., Neto,A.V., Chaucanez,C.B., Silva,P.A., Cunha,O.L.,
            de Oliveira,F.F., dos Santos,T.C., Barros,A.L., Soares,M.A., de
            Oliveira,L.M., Marini,M.M., Villalobos-Duno,H., Cunha,M.M., de
            Hoog,S., da Silveira,J.F., Henrissat,B., Nino-Vega,G.A.,
            Cisalpino,P.S., Mora-Montes,H.M., Almeida,S.R., Stajich,J.E.,
            Lopes-Bezerra,L.M., Vasconcelos,A.T. and Felipe,M.S.
  TITLE     Comparative genomics of the major fungal agents of human and animal
            Sporotrichosis: Sporothrix schenckii and Sporothrix brasiliensis
  JOURNAL   BMC Genomics 15, 943 (2014)
   PUBMED   25351875
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 3315)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (15-APR-2021) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 3315)
  AUTHORS   Teixeira,M.M., Almeida,L.G., Souza,R.C., Lopes-Bezerra,L.M.,
            Vasconcelos,A.T., Felipe,M.S. and Siervo,M.A.
  TITLE     Direct Submission
  JOURNAL   Submitted (12-SEP-2013) Labinfo, LNCC - Laboratorio Nacional de
            Computacao Cientifica, Rua Getulio Vargas 333, Petropolis, RJ
            25651070, Brazil
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_024467136).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..3315
                     /organism="Sporothrix brasiliensis 5110"
                     /mol_type="mRNA"
                     /strain="5110"
                     /isolation_source="feline skin lesion of sporotrichosis"
                     /host="Felis catus"
                     /culture_collection="ATCC:MYA-4823"
                     /db_xref="taxon:1398154"
                     /chromosome="Unknown"
                     /lat_lon="22.90 S 43.17 W"
                     /collection_date="2007"
     gene            <1..>3315
                     /locus_tag="SPBR_02199"
                     /db_xref="GeneID:63675423"
     CDS             1..3315
                     /locus_tag="SPBR_02199"
                     /note="identified by sequence similarity"
                     /codon_start=1
                     /product="RNA interference and protein silencing protein"
                     /protein_id="XP_040620565.1"
                     /db_xref="GeneID:63675423"
                     /translation="

MTREAGDVAVEAVTVVIVVVAEAAAGMHLRGAVVEAAGAEKDIVAAIVVVVKVAEAGVVTSVVIVETSMAEVTVDVAEVTAGAGTEGAAAAASSMSACAVVEAAVAVTLVVEVSIVTLEDQLMKTSLGNREQASAATDRFRFPHRPSYGREGKPIEVWANYFELGIAKMPSLFLYTFHVHKGRPPSDDNASTSATSQQGAKIKGPFLRKILKHILGTDLDVPGLSPRTELQSKLITLQRISQETIDRLKDTHFDGDHFEVELDGPHTLDLDSLRTWLSTMHDGRDAQDLSFPKFQNLMDVIGIIMGHGPRMGGSNLHEDNPRTVAVGRSRFFPVDETREAELFHRSRPLEILRGYFQSVRPSTGRLLLNVNVTHSVFRSSRERPFFELFRDCHFRDLEQSLKGARVRITYPDLSHKEYTVSGFVMKPGGGGGYGETRFKKISEVTFTFTLNEPGTGSSKKRGGKKTAAQKPTGKQITVRDYLKDRVRAIPYSIRPRGALCYLDSLGTASCLAMIPRRPELNAKSIVSVGRQALQLDNLDASFRDYRITVGDKLITVDARVLPAPDLVYGKKFKMAPQRGSWNLASRELAQGGSNNMSNVKWAYYEMPGSRGDVRLAMDSFMTSLKALAVPVSEAPLQLGRQGDYSMFDTRTFDGKDGAIDAAFRRAVQSAPKPKIILFVLADNDKYVYERIKLLGDTVFGIHSVCVVSQKFTRNDAQYFANVALKFNLKLGGVNHRLDKPDKLGIISKGKTMVVGYDIIHPTNLGAGKDVQDLPSHVGLVASIDKDLAQWPACQWSQTGRQEMTSDELTEAFKSRLERWREHNGAYPDNILVYRDGVSEGQFEQVLDTELPKMKTALKSVDQSKTKITIVISVKRHNTRFFPTKAEEMSRSGNIECGTVVDRGITLQRYWDFFLTAHTAIQGTARPARYTVIYDEIFQSRGGDPSMSTGELEKITYNMCYLFSRATKSVSICPPAYYADLVCTRARLYQSKLFNQAMEGSDSDPADRVFPQVHPDARAAISALVTTVTYTDRIDDNEPQSPVAYPGRLGKKLQVSRKAATVQNVHLGLVLAQAASIHLVAKNVERNVPQENDIVGCQCRKKRRQ"

     misc_feature    973..1134
                     /locus_tag="SPBR_02199"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    1624..2964
                     /locus_tag="SPBR_02199"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(2062..2064,2074..2076,2110..2121,2128..2130,
                     2152..2154,2161..2163,2173..2175,2185..2187)
                     /locus_tag="SPBR_02199"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(2269..2271,2275..2277,2503..2505,2935..2937)
                     /locus_tag="SPBR_02199"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      

atgacgcgcgaggccggggacgtggccgtggaggcggtgaccgtggtgatcgtggtggtcgccgaggccgcggcgggcatgcacctgcgaggggcggtggtagaggcggcaggggcggagaaggacatcgtggcagcgatcgtggtagtcgtgaaggtggccgaggccggggtagtgacctcggtggtcatcgtggagacttccatggcggaggtgaccgtggacgtggcggaggtgaccgcgggggcgggtacagagggcgcggcggcggcggccagttcgatgtcagcatgcgcggtagtcgaggcggccgtggcggttacgttggtcgtggaggtgagcatcgtcacgctcgaggaccagcttatgaaaacctccttgggcaacagggagcaggcatcggcggccacagacaggttccgcttcccgcatcggccgtcgtacggccgcgagggcaagccaatcgaggtttgggccaactactttgagctgggcatcgccaaaatgccatctctatttctttatacgttccatgtgcacaaggggcggccgccttcggatgacaacgcaagcacttctgccaccagccaacagggcgccaagatcaaagggccgtttttgcgcaagatacttaagcatattctggggacagacttggacgtgccaggactgtcaccccggaccgagcttcaaagcaagttaatcacgctccagcgcatctctcaggaaactatcgatcggctgaaggacacccattttgacggcgaccattttgaagtggagttggatgggccgcacacactcgacctggacagtctccggacgtggcttagcaccatgcacgacgggcgcgacgcgcaagatctgagcttccccaagttccaaaatctgatggatgtcattggcattattatgggccatggcccccgaatgggtggctccaacctccacgaggacaacccacgcacagtggccgtcggccgcagtcgcttcttcccagtcgatgagacgagagaggccgagcttttccatcggtcgcggcccctcgagattctgcgcggctacttccagagcgtacggccttctacagggcggctgctcctcaatgtcaacgtcactcacagcgtattccgctcctcccgggagcggccgttctttgagcttttccgggactgccatttccgcgaccttgagcagtcgttgaagggcgcgcgcgtccgcatcacctacccggacctgtcccacaaggagtacaccgtgtctggctttgtgatgaagcccggcggtggtggtggctatggcgagacccggttcaagaagatcagcgaggtcactttcactttcacactgaacgagcctggtacgggctcgtctaagaagaggggcgggaaaaagactgctgcgcaaaagcccacaggcaagcagatcactgtccgggactacttgaaggacagagtcagagcaatcccgtattctatccggcctcgtggtgctctctgctacctggacagccttggaaccgcaagctgtctggcgatgataccccgccggcccgaattgaatgccaagtccattgtgagtgtcggccgccaggctctccaactggacaacctcgacgcctcgttcagggactaccgcatcacagtcggcgacaagcttatcacggtcgacgccagagtcttgcctgcccctgatctggtctacgggaagaagttcaagatggcgccgcagcgcggttcctggaacctggcatcgcgcgagctggctcagggcggctcaaataatatgagtaacgtcaagtgggcgtactacgagatgcccggatctcgtggtgacgtgagattagccatggactcattcatgacctcactgaaggcacttgccgtgccagtgagtgaggcgccgcttcagcttggccgacagggagactacagcatgttcgacacgcgcacattcgacggaaaagacggtgcgattgatgccgcattccggcgtgctgtccagagcgcacccaagccgaagatcatcttgtttgttctggccgacaacgacaagtacgtgtacgagcgcatcaagctgctcggtgacacggtgtttggcattcactcggtgtgcgtagtatcgcaaaagttcactagaaatgacgctcaatacttcgcaaacgtggcactcaaattcaacctcaagctcggtggcgtcaaccacagactcgacaagccggacaagctcggcatcatctcgaagggcaagaccatggtcgttgggtacgacatcatccacccaacgaacttgggcgccggcaaagatgtgcaggacttgcccagccatgtcgggctcgtggccagtatcgacaaagacctcgcccagtggccggcgtgtcagtggagccagactggtcgccaggaaatgacgtcggatgaactgaccgaggctttcaagtctcgtctggagcgctggcgcgagcacaacggtgcgtacccggacaatattctggtgtaccgcgacggcgtctctgagggacagttcgagcaggtactggacaccgagctgccgaagatgaagacggcgctcaagagcgtcgaccagtcgaagacgaaaattacgattgtcatctcggtgaagcggcacaacacacgcttcttcccgaccaaggcggaagagatgtcccgatcgggcaacattgaatgcggcacggtggtggaccgcggcatcacgctgcagcgctactgggacttcttcctcacggcacacacggctatccagggaacagcacgccctgcacggtacacggtgatctacgacgagatcttccagagccgcggcggcgaccccagcatgtcgacgggcgagctcgagaagattacgtacaacatgtgctacctgttcagccgggcgaccaagtcggtcagcatctgccccccggcatactatgcagacctcgtgtgcacgcgggcacggctgtaccagagcaagctattcaaccaggccatggaggggtcagattcggacccggcggaccgggtgttcccgcaggtgcaccctgacgctcgcgctgccatcagcgccctcgtcaccacggtcacgtacactgacaggatcgacgataacgaaccgcagagcccagttgcgtacccgggccgtcttggcaagaagctgcaggtcagccggaaggccgccacggtgcagaatgtgcaccttggtctggtccttgcgcaggctgcttccatacaccttgtcgccaaaaacgtggagcgcaacgtgccgcaagagaacgacatcgtggggtgccagtgtcggaagaagcgtcgccagtga

//