GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-02 07:02:56, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_035620582            2774 bp    mRNA    linear   VRT 01-APR-2022
DEFINITION  PREDICTED: Scophthalmus maximus argonaute RISC component 4 (ago4),
            transcript variant X4, mRNA.
ACCESSION   XM_035620582
VERSION     XM_035620582.1
DBLINK      BioProject: PRJNA821077
KEYWORDS    RefSeq.
SOURCE      Scophthalmus maximus (turbot)
  ORGANISM  Scophthalmus maximus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Carangaria; Pleuronectiformes; Pleuronectoidei;
            Scophthalmidae; Scophthalmus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_061536) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Scophthalmus maximus Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2774
                     /organism="Scophthalmus maximus"
                     /mol_type="mRNA"
                     /strain="ysfricsl-2021"
                     /db_xref="taxon:52904"
                     /chromosome="22"
                     /sex="female"
                     /tissue_type="muscle"
     gene            1..2774
                     /gene="ago4"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 3 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 91 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:118291986"
     CDS             177..2774
                     /gene="ago4"
                     /codon_start=1
                     /product="protein argonaute-4 isoform X4"
                     /protein_id="XP_035476475.1"
                     /db_xref="GeneID:118291986"
                     /translation="
MEALGPGCSVGEDITDSQPGNSAVADKGAPAPASLFQPPRRPGLGTVGKPIRLLANHFQVQIPKIDVYHYDIDIKPEKRPRRVNREVVDTMVRHFKMQIFGDRQPGYDGKRNMYTAHPLPIGRDRVDLEVTLPGEGKDQTFKVSLQWVSVVSLQMLLEALSGHLNEVPEDSVQALDVITRHLPSMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWNMMLNIDVSATAFYRAQPVIEFMCEVLDIQNINEQTKPLTDSQRVKFTKEIRGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLENGQAMECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVKSNSMVGGPDPYLKEFGIVVHNDMTEVTGRVLPAPMLQYGGRVSTDTGRDCGRGLSPQNKTVATPNQGVWDMRGKQFYAGIEIKVWAVACFAPQKQCREDLLKSFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFKHLKMSYVGLQLIVVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINAKLGGINNVLVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDGHPSRYCATVRVQTSRQDMSQEQLFSQEVIQDLTNMVRELLIQFYKSTRFKPTRIIYYRGGVSEGQMKQVAWPELIAIRKACISLEEDYRPGITYIVVQKRHHTRLFCSDKAERVGKSGNVPAGTTVDSTITHPSEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKDHDR"
     misc_feature    321..710
                     /gene="ago4"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:435368"
     misc_feature    741..893
                     /gene="ago4"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    894..1256
                     /gene="ago4"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(1050..1052,1095..1097,1137..1139,1149..1151,
                     1203..1205,1224..1226,1230..1232)
                     /gene="ago4"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1395..2750
                     /gene="ago4"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1854..1856,1866..1868,1902..1913,1920..1922,
                     1944..1946,1953..1955,1965..1967,1977..1979)
                     /gene="ago4"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(2058..2060,2064..2066,2304..2306,2718..2720)
                     /gene="ago4"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
aggcagcagaagcggtagctcggctctgttggttcaggcagcagtcgtccacgcatctatctatatttcccatttttcttaaattagcccctttaagcttcgcgataccgcccccaatttcagcgacggtacggagccgccaggccgggactgagacggagagagaggcctcggccatggaagccctcggacccggttgttctgtcggagaggatataacagacagtcagcctggtaactcggcggtggctgataaaggagcaccagctccggcctctctgttccagcctccacggcgtcccggccttggcacggtggggaaacccatccggctccttgccaaccactttcaggtgcagattcccaagattgatgtctatcactatgatatcgacatcaagcctgagaaacggcctcggagggtcaacagggaggtggtggacaccatggtgcggcacttcaagatgcagatctttggagaccggcagcctggctacgatgggaagaggaacatgtacacagcacatccactgccaataggaagagacagggtggatctggaggtgaccctgcccggcgaggggaaggatcagacgttcaaagtgtctttgcagtgggtgtccgtggtcagtcttcagatgctactggaggccctctcaggccacctgaacgaggtccccgaagactcggttcaggccctggatgtcatcacgcggcacctgccttccatgaggtacactccagtggggcgttcatttttctcccctccggagggctactaccatcccctcggtggaggcagggaggtgtggtttggttttcatcagtctgtccgtcctgccatgtggaacatgatgctcaacatcgacgtgtcggccactgctttctaccgcgctcagcccgtgatagagttcatgtgcgaggtgcttgatatacagaacatcaacgaacagaccaaaccgctgacggactcgcagcgtgtcaaattcaccaaggaaataagaggcttgaaagttgaggtcacacattgtggtcagatgaagaggaagtatcgtgtgtgcaatgtcacgcgccgacctgccagccaccaaacgttccccttacagcttgagaacggccaagccatggagtgcacagtagctcagtatttcaagcagaagtacaatctgcagctcaagtatccacatttaccctgtctgcaagtggggcaggaacagaagcacacctatcttcccctggaggtctgcaacatagtcgcaggccagcgctgtatcaagaaactgacagacaaccagacatccaccatgattaaagcaacagctcgctcggcccccgacagacaggaagagatcagcagactggtcaaaagcaacagtatggttgggggcccggacccttacctgaaggaatttggcattgtggtgcacaacgacatgacagaagtgacagggcgtgttctcccagcgcccatgctgcagtacgggggccgggtgagcacggacacaggacgggactgtggcaggggactctctccgcagaataagacggtggccacgcccaaccagggcgtgtgggacatgagagggaagcagttctacgccggcatcgagatcaaggtctgggccgtggcctgtttcgcccctcagaaacagtgtcgagaggacctgctcaagagcttcactgaccagctgcgaaagatctcaaaggatgctgggatgccaatccaaggccagccgtgcttctgtaaatacgcccaaggagccgacagcgtggagcccatgttcaaacacctcaaaatgtcttacgtgggtctgcagctgattgtggtcattctgcctggcaaaacacctgtctatgctgaggtgaagcgggtgggagacacgctcctcggcatggccacacagtgtgtccaggtgaagaacgtagtgaagacgtcccctcagaccctctccaacctctgcctcaagatcaacgccaagctgggaggcatcaacaacgtcctggtgcctcatcagaggccctccgtgttccagcagcccgtcatcttcctgggcgccgacgtgacccatcccccggcgggcgacggcaagaagccgtccatcgctgcagtggtgggcagcatggacggccaccccagcagatactgtgcgacggtgcgagtccagacgtcacggcaggacatgtcccaggagcagctcttcagccaggaggttatccaggacctgaccaacatggtgcgggagctgctcatccagttttacaagtccacgcgcttcaagcccacccgcatcatctactatcgtggcggcgtgtccgagggacagatgaaacaggtagcgtggccagagctgatagccatccgaaaggcttgcatcagtctggaggaggattatcggccgggcatcacctacatcgtggtccagaaacgacaccacactcgtctcttctgctctgacaaagccgagagggttgggaagagcggtaacgtcccagctggcaccacggtggacagtaccatcacacacccgtccgagttcgacttctacctgtgcagccatgctgggattcagggaaccagccgtccctcccactaccacgtcctgtgggacgacaactgtttcacggctgacgagctgcagctcctcacctaccagctgtgccacacctacgtccgctgcactcgctccgtctccatcccggcgccggcctactacgcccgactggtggccttccgagcccgctaccacctggtggacaaagaccatgacaggtga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]