2024-05-11 12:19:41, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_030011679 3183 bp mRNA linear VRT 03-MAY-2021 DEFINITION PREDICTED: Aquila chrysaetos chrysaetos argonaute RISC catalytic component 2 (AGO2), transcript variant X2, mRNA. ACCESSION XM_030011679 VERSION XM_030011679.2 DBLINK BioProject: PRJNA556399 KEYWORDS RefSeq. SOURCE Aquila chrysaetos chrysaetos ORGANISM Aquila chrysaetos chrysaetos Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Accipitriformes; Accipitridae; Accipitrinae; Aquila. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_044007.1) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On Apr 30, 2021 this sequence version replaced XM_030011679.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Aquila chrysaetos chrysaetos Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.6 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3183 /organism="Aquila chrysaetos chrysaetos" /mol_type="mRNA" /sub_species="chrysaetos" /db_xref="taxon:223781" /chromosome="4" gene 1..3183 /gene="AGO2" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:115340289" CDS 70..2673 /gene="AGO2" /codon_start=1 /product="protein argonaute-2 isoform X2" /protein_id="XP_029867539.1" /db_xref="GeneID:115340289" /translation="
MYPGATSAGPVLAPPPPLPPPIQGYAFKPPPRPDFGTSGRTIKLQANFFEMDIPKIDIYHYELDIKPEKCPRRVNREIVEHMVQHFKTQIFGDRKPVFDGRKNLYTAMPLPIGRDKVELEVTLPGEGKDRIFKVAIKWMSCVSLQALHDALSGRLPSVPFETIQALDVVMRHLPSMRYTPVGRSFFTASEGCSNPLGGGREVWFGFHQSVRPSLWKMMLNIDVSATAFYKAQPVIEFVCEVLDFKSIEEQQKPLTDSQRVKFTKEIKGLKVEITHCGQMKRKYRVCNVTRRPASHQTFPLQQENGQTVECTVAQYFKDRHKLVLRYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIRATARSAPDRQEEISKLMRSASFNTDPYVREFGIMVKDEMTDVTGRVLQPPSILYGGRNKAIATPVQGVWDMRNKQFHTGIEIKVWAIACFAPQRQCTEVHLKSFTEQLRKISRDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYTGLQLVVVILPGKTPVYAEVKRVGDTVLGMATQCVQMKNVQRTTPQTLSNLCLKINVKLGGVNNILLPQGRPPVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPNRYCATVRVQQHRQEIIQDLAAMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFQQVLHHELLAIREACIKLEKDYQPGITFIVVQKRHHTRLFCTDKNERVGKSGNIPAGTTVDTKITHPSEFDFYLCSHAGIQGTSRPSHYHVLWDDNRFSSDELQILTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDRCTPHHFAAWLQGESDCQGQREDMAHTRSLPKQSGSAQAA"
misc_feature 355..579 /gene="AGO2" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:435368" misc_feature 607..759 /gene="AGO2" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:430160" misc_feature 760..1122 /gene="AGO2" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(916..918,961..963,1003..1005,1015..1017,1069..1071, 1090..1092,1096..1098) /gene="AGO2" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1255..2532 /gene="AGO2" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1666..1668,1678..1680,1714..1725,1732..1734, 1756..1758,1765..1767,1777..1779,1789..1791) /gene="AGO2" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(1870..1872,1876..1878,2086..2088,2500..2502) /gene="AGO2" /note="active site" /db_xref="CDD:240015" ORIGIN
ctcccctcgagctgccgccgcggtagggacctggagagaggcgccgcctccgccgccgcacacggagacatgtacccgggagccacctccgccggacccgtgcttgcacctcctccgccattgccaccaccaatacagggatatgcctttaaacctcctcctcgaccagattttggcacttctgggagaacaatcaaactgcaggccaacttctttgaaatggacattcctaaaatagatatctaccattacgaattggatataaagccagaaaaatgccccagaagagttaacagagaaatagtcgagcatatggttcagcactttaaaacccagatttttggggatcgcaaaccggtgtttgatggaagaaaaaacctttatacagctatgccacttcccattgggagagataaagtggagctggaggtcacgctgccaggagaaggaaaggacagaatatttaaggtggctataaagtggatgtcctgtgtgagtttgcaggctttacatgatgctctttctggtcggctgccaagtgtcccgtttgaaaccatccaggcactggatgtagtgatgaggcacttgccttccatgagatatactcctgtggggcgatctttttttacagcatcagaagggtgctcgaatccattggggggtggcagagaagtttggtttggcttccatcagtcagtcagaccttcattatggaaaatgatgttaaatattgatgtatctgcaacagcattttacaaagcacagccagttatcgagtttgtatgtgaagttttggacttcaaaagtattgaagaacaacaaaaacctctgacagattcccaaagggtaaagtttaccaaagaaataaaaggtctaaaggtggagataacacactgtggacaaatgaaaaggaagtacagagtgtgcaatgtcaccagacgaccagcaagtcaccaaacattcccacttcagcaggagaatggacaaacagttgaatgcactgtagctcagtattttaaggacaggcacaaattagttttacgctatcctcaccttccatgtttacaagttggacaggagcagaaacacacataccttcctctggaggtgtgcaacatagtggcaggacaaagatgcataaagaaactcactgacaatcaaacttccactatgattcgagcaactgccagatcagcacctgaccgtcaagaagagattagcaaattgatgcggagtgccagttttaataccgacccttatgttcgtgaatttggaataatggtcaaagatgaaatgacagatgtgaccggcagagttctacagcctccttcaatcctctatggaggcaggaataaagcaattgctacaccagttcaaggagtctgggacatgaggaataaacagtttcacactggaattgaaataaaggtttgggcaattgcgtgctttgctccccagcgccaatgcactgaagttcatctgaagtcctttacagaacaactgaggaaaatttccagagatgcaggaatgccaatccaggggcagccgtgcttctgtaaatacgcgcagggagctgacagtgtggagcccatgttcagacatctcaagaacacttacactgggctgcagcttgttgtagtaattttgccaggaaaaacgccagtctatgcggaagtgaagcgtgttggcgacactgtgctgggaatggctacacagtgtgttcagatgaaaaatgtgcaaagaacaacaccgcaaactctgtctaacctttgcttaaaaataaatgtcaaattaggaggcgtaaataatattttactgccacagggaagaccaccagtatttcaacagcctgtcatattccttggtgcagatgtaactcatccgccagctggagatggaaaaaaaccttccattgctgcagttgtaggaagtatggatgctcatcctaatcgatactgtgccactgttcgggtccagcagcaccgccaagaaatcatccaagatttggctgccatggtcagggagttgcttattcagttctacaaatcaactagatttaaaccaactcgtataatcttctacagagatggtgtttctgaggggcagtttcaacaggttctccatcatgaattgctggctatcagagaagcatgcattaaactagaaaaggattaccagcctggaattacatttatagttgtgcagaaaaggcatcacaccagactcttctgtacagataaaaatgaacgggttggaaaaagtggaaacattccagctggtaccacagtggacacaaaaatcacccatccatcagagtttgacttttacctgtgtagtcatgctggtattcagggaacaagcagaccttctcattaccatgtcctctgggatgacaatcgtttctcttcagatgaactgcagattcttacctaccagctgtgtcatacatatgtacgctgtactcgttccgtttccatcccagcaccagcatattacgcgcacctggttgccttcagagccaggtatcatctggtggataaagaacacgataggtgcacaccacatcattttgcagcctggctacagggagaaagcgactgccagggccaacgtgaggacatggctcataccaggtctcttcccaagcagtctggttcagctcaggctgcgtagccaccgcttgggctgcgggtccaagacagaaaggacacgttcccctctgctgtgaatgaggctgggttgcaggacaatgaagcacggcggtctgctggtgtgagatacttctgaccagggacacctctgccagttgtgaacatagcccagcggcggaaagaaaaaccctcccgcatcgctcacagactcggggagctcagctggacgggacgacgcccaaaccccccttttgcacagcgggagccttgaagggcgacgcttcatggccgccgactgacagacacaggtagcctgtaacatgtcgatggatgatgtgtcggcctcggcctgcggaaggcagtgggggttttgctactgacagcgttggctccagaagtttgtctgtgcctgttcgggtcagagctaccgtgctcccaccgggagtgagttagcgcttccagaaatgatgatgcatagttggcatttcattaatggcttgaataaaaagtctctagtatgcttcacaaacaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]