GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-11 12:19:41, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_030011679            3183 bp    mRNA    linear   VRT 03-MAY-2021
DEFINITION  PREDICTED: Aquila chrysaetos chrysaetos argonaute RISC catalytic
            component 2 (AGO2), transcript variant X2, mRNA.
ACCESSION   XM_030011679
VERSION     XM_030011679.2
DBLINK      BioProject: PRJNA556399
KEYWORDS    RefSeq.
SOURCE      Aquila chrysaetos chrysaetos
  ORGANISM  Aquila chrysaetos chrysaetos
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Accipitriformes; Accipitridae;
            Accipitrinae; Aquila.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044007.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Apr 30, 2021 this sequence version replaced XM_030011679.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Aquila chrysaetos chrysaetos
                                           Annotation Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.6
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3183
                     /organism="Aquila chrysaetos chrysaetos"
                     /mol_type="mRNA"
                     /sub_species="chrysaetos"
                     /db_xref="taxon:223781"
                     /chromosome="4"
     gene            1..3183
                     /gene="AGO2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 ESTs, 2 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments"
                     /db_xref="GeneID:115340289"
     CDS             70..2673
                     /gene="AGO2"
                     /codon_start=1
                     /product="protein argonaute-2 isoform X2"
                     /protein_id="XP_029867539.1"
                     /db_xref="GeneID:115340289"
                     /translation="
MYPGATSAGPVLAPPPPLPPPIQGYAFKPPPRPDFGTSGRTIKLQANFFEMDIPKIDIYHYELDIKPEKCPRRVNREIVEHMVQHFKTQIFGDRKPVFDGRKNLYTAMPLPIGRDKVELEVTLPGEGKDRIFKVAIKWMSCVSLQALHDALSGRLPSVPFETIQALDVVMRHLPSMRYTPVGRSFFTASEGCSNPLGGGREVWFGFHQSVRPSLWKMMLNIDVSATAFYKAQPVIEFVCEVLDFKSIEEQQKPLTDSQRVKFTKEIKGLKVEITHCGQMKRKYRVCNVTRRPASHQTFPLQQENGQTVECTVAQYFKDRHKLVLRYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIRATARSAPDRQEEISKLMRSASFNTDPYVREFGIMVKDEMTDVTGRVLQPPSILYGGRNKAIATPVQGVWDMRNKQFHTGIEIKVWAIACFAPQRQCTEVHLKSFTEQLRKISRDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYTGLQLVVVILPGKTPVYAEVKRVGDTVLGMATQCVQMKNVQRTTPQTLSNLCLKINVKLGGVNNILLPQGRPPVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPNRYCATVRVQQHRQEIIQDLAAMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFQQVLHHELLAIREACIKLEKDYQPGITFIVVQKRHHTRLFCTDKNERVGKSGNIPAGTTVDTKITHPSEFDFYLCSHAGIQGTSRPSHYHVLWDDNRFSSDELQILTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDRCTPHHFAAWLQGESDCQGQREDMAHTRSLPKQSGSAQAA"
     misc_feature    355..579
                     /gene="AGO2"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:435368"
     misc_feature    607..759
                     /gene="AGO2"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    760..1122
                     /gene="AGO2"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(916..918,961..963,1003..1005,1015..1017,1069..1071,
                     1090..1092,1096..1098)
                     /gene="AGO2"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1255..2532
                     /gene="AGO2"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1666..1668,1678..1680,1714..1725,1732..1734,
                     1756..1758,1765..1767,1777..1779,1789..1791)
                     /gene="AGO2"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1870..1872,1876..1878,2086..2088,2500..2502)
                     /gene="AGO2"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
ctcccctcgagctgccgccgcggtagggacctggagagaggcgccgcctccgccgccgcacacggagacatgtacccgggagccacctccgccggacccgtgcttgcacctcctccgccattgccaccaccaatacagggatatgcctttaaacctcctcctcgaccagattttggcacttctgggagaacaatcaaactgcaggccaacttctttgaaatggacattcctaaaatagatatctaccattacgaattggatataaagccagaaaaatgccccagaagagttaacagagaaatagtcgagcatatggttcagcactttaaaacccagatttttggggatcgcaaaccggtgtttgatggaagaaaaaacctttatacagctatgccacttcccattgggagagataaagtggagctggaggtcacgctgccaggagaaggaaaggacagaatatttaaggtggctataaagtggatgtcctgtgtgagtttgcaggctttacatgatgctctttctggtcggctgccaagtgtcccgtttgaaaccatccaggcactggatgtagtgatgaggcacttgccttccatgagatatactcctgtggggcgatctttttttacagcatcagaagggtgctcgaatccattggggggtggcagagaagtttggtttggcttccatcagtcagtcagaccttcattatggaaaatgatgttaaatattgatgtatctgcaacagcattttacaaagcacagccagttatcgagtttgtatgtgaagttttggacttcaaaagtattgaagaacaacaaaaacctctgacagattcccaaagggtaaagtttaccaaagaaataaaaggtctaaaggtggagataacacactgtggacaaatgaaaaggaagtacagagtgtgcaatgtcaccagacgaccagcaagtcaccaaacattcccacttcagcaggagaatggacaaacagttgaatgcactgtagctcagtattttaaggacaggcacaaattagttttacgctatcctcaccttccatgtttacaagttggacaggagcagaaacacacataccttcctctggaggtgtgcaacatagtggcaggacaaagatgcataaagaaactcactgacaatcaaacttccactatgattcgagcaactgccagatcagcacctgaccgtcaagaagagattagcaaattgatgcggagtgccagttttaataccgacccttatgttcgtgaatttggaataatggtcaaagatgaaatgacagatgtgaccggcagagttctacagcctccttcaatcctctatggaggcaggaataaagcaattgctacaccagttcaaggagtctgggacatgaggaataaacagtttcacactggaattgaaataaaggtttgggcaattgcgtgctttgctccccagcgccaatgcactgaagttcatctgaagtcctttacagaacaactgaggaaaatttccagagatgcaggaatgccaatccaggggcagccgtgcttctgtaaatacgcgcagggagctgacagtgtggagcccatgttcagacatctcaagaacacttacactgggctgcagcttgttgtagtaattttgccaggaaaaacgccagtctatgcggaagtgaagcgtgttggcgacactgtgctgggaatggctacacagtgtgttcagatgaaaaatgtgcaaagaacaacaccgcaaactctgtctaacctttgcttaaaaataaatgtcaaattaggaggcgtaaataatattttactgccacagggaagaccaccagtatttcaacagcctgtcatattccttggtgcagatgtaactcatccgccagctggagatggaaaaaaaccttccattgctgcagttgtaggaagtatggatgctcatcctaatcgatactgtgccactgttcgggtccagcagcaccgccaagaaatcatccaagatttggctgccatggtcagggagttgcttattcagttctacaaatcaactagatttaaaccaactcgtataatcttctacagagatggtgtttctgaggggcagtttcaacaggttctccatcatgaattgctggctatcagagaagcatgcattaaactagaaaaggattaccagcctggaattacatttatagttgtgcagaaaaggcatcacaccagactcttctgtacagataaaaatgaacgggttggaaaaagtggaaacattccagctggtaccacagtggacacaaaaatcacccatccatcagagtttgacttttacctgtgtagtcatgctggtattcagggaacaagcagaccttctcattaccatgtcctctgggatgacaatcgtttctcttcagatgaactgcagattcttacctaccagctgtgtcatacatatgtacgctgtactcgttccgtttccatcccagcaccagcatattacgcgcacctggttgccttcagagccaggtatcatctggtggataaagaacacgataggtgcacaccacatcattttgcagcctggctacagggagaaagcgactgccagggccaacgtgaggacatggctcataccaggtctcttcccaagcagtctggttcagctcaggctgcgtagccaccgcttgggctgcgggtccaagacagaaaggacacgttcccctctgctgtgaatgaggctgggttgcaggacaatgaagcacggcggtctgctggtgtgagatacttctgaccagggacacctctgccagttgtgaacatagcccagcggcggaaagaaaaaccctcccgcatcgctcacagactcggggagctcagctggacgggacgacgcccaaaccccccttttgcacagcgggagccttgaagggcgacgcttcatggccgccgactgacagacacaggtagcctgtaacatgtcgatggatgatgtgtcggcctcggcctgcggaaggcagtgggggttttgctactgacagcgttggctccagaagtttgtctgtgcctgttcgggtcagagctaccgtgctcccaccgggagtgagttagcgcttccagaaatgatgatgcatagttggcatttcattaatggcttgaataaaaagtctctagtatgcttcacaaacaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]