LOCUS       XM_030007518            1800 bp    mRNA    linear   VRT 03-MAY-2021
DEFINITION  PREDICTED: Aquila chrysaetos chrysaetos vimentin (VIM), mRNA.
ACCESSION   XM_030007518
VERSION     XM_030007518.2
DBLINK      BioProject: PRJNA556399
KEYWORDS    RefSeq.
SOURCE      Aquila chrysaetos chrysaetos
  ORGANISM  Aquila chrysaetos chrysaetos
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Accipitriformes; Accipitridae;
            Accipitrinae; Aquila.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044006.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Apr 30, 2021 this sequence version replaced XM_030007518.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Aquila chrysaetos chrysaetos
                                           Annotation Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.6
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1800
                     /organism="Aquila chrysaetos chrysaetos"
                     /mol_type="mRNA"
                     /sub_species="chrysaetos"
                     /db_xref="taxon:223781"
                     /chromosome="3"
     gene            1..1800
                     /gene="VIM"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 mRNA, 257 ESTs, 56 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 19 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:115338746"
     CDS             97..1476
                     /gene="VIM"
                     /codon_start=1
                     /product="vimentin"
                     /protein_id="XP_029863378.1"
                     /db_xref="GeneID:115338746"
                     /translation="

MSISTKNSSYRRMFGGGSRPSTGTRYITSSSRYSLGSSLRPSTARYVSASPGGMYATKATSVRLRSSMPPMRLHDSVDFSLADAINTEFKANRTNEKVELQELNDRFANYIDKVRFLEQQNKILLAELEQLKGKGTSRLGDLYEEEMRELRRQVDQLTNDKARVEVERDNLADDIMRLREKLQEEMLQREEAENTLQSFRQDVDNASLARLDLERKVESLQEEIVFLKKLHDEEIRELQAQLQEQHIQIDMDVSKPDLTAALRDVRQQYESVAAKNLQEAEEWYKSKFADLSEAANRNNDALRQAKQEANEYRRQIQSLTCEVDALKGSNESLERQMREMEENFAVEAANYQDTIGRLQDEIQNMKEEMARHLREYQDLLNVKMALDIEIATYRKLLEGEESRINMPIPTFASLNLRETNIESQPMVDTHSKRTLLIKTVETRDGQVINETSQHHDDLE"

     misc_feature    118..378
                     /gene="VIM"
                     /note="Intermediate filament head (DNA binding) region;
                     Region: Filament_head; pfam04732"
                     /db_xref="CDD:428095"
     misc_feature    379..1305
                     /gene="VIM"
                     /note="Intermediate filament protein; Region: Filament;
                     pfam00038"
                     /db_xref="CDD:425436"
ORIGIN      

ggcgaggccgccgctcttcttcgcccgccgcgcactcgagccgccccgctccgctccgctccgctcccggattacaaagcccgcgccgccgccgccatgagcatcagcacgaagaactcctcgtaccgccgcatgttcggcgggggcagccgccccagcaccggcacccgctacatcacctccagcagccgctactcgctgggcagctccctgcggcccagcaccgcccggtacgtgtccgcctcgcccggcggcatgtacgccaccaaggcgacgtcggtgcggctgcggagcagcatgccgcccatgcggctccacgactccgtggacttctccctggccgacgccatcaacacggagttcaaggcgaaccgcaccaacgagaaggtggagctgcaggagctcaacgaccgcttcgccaactacatcgacaaggtgcgcttcctggagcagcagaacaagatcctgctggccgagctggagcagctcaagggcaagggcacgtcccgcctgggcgacctctacgaggaggagatgcgggagctgcgccggcaggtggaccagctcaccaacgacaaggcacgcgtggaagtggagcgggacaacctcgccgacgacatcatgcggctgagggagaagttgcaagaggagatgctgcagcgggaagaggccgagaacaccctgcagtccttcagacaggatgtcgacaatgcctctctggcacgtcttgatcttgagcgcaaagttgagtccctgcaagaggagattgtcttcttgaagaagcttcatgatgaggaaatccgagaactgcaggcccaactccaggaacagcacatccaaattgatatggatgtttctaagcctgatcttactgctgccctgcgtgatgttcgccaacagtatgaaagcgttgctgctaagaatcttcaggaagctgaagagtggtacaagtccaaatttgcagatctctctgaagctgctaataggaacaatgatgccctgcgccaggccaaacaagaagctaatgaataccgcagacagattcagtctctcacctgtgaagttgatgcccttaagggaagcaatgaatccctggagcgccaaatgcgtgaaatggaggagaattttgctgttgaagctgctaactaccaagacactattggccgcctgcaggatgagattcagaacatgaaggaagaaatggctcgccatctccgcgagtaccaggacctgctgaatgtaaagatggctcttgatattgagattgccacctacagaaaactgctggagggtgaagagagcaggattaacatgcctattccaacctttgcttccttgaacctgagagaaaccaacattgagtctcagccaatggttgacactcactcaaagaggacacttctaattaagactgttgaaactagagacggacaggttattaatgaaacttcccagcatcatgatgacttggagtaaagctgaagtgaagatgcatacttattaatgcaggagaaattcttaccagcatgatttaaaaagtccatgtcttaaaggaagaaacagctttcaagtgcctttctgcagtttttccatgagcgcaagattattatgctaggaaataggtcttagatcttgcaaactgactctccctgaaggattagagtttacaatggagtctagtttacaaatagcaatatcttgtgctgcaatactgtttttaagtatctgaattcaataaaactgctttttccagcacagtatgagcaacctgtcgctacttcaataaatctttggaaaatg

//