GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-25 05:27:49, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_022824234             576 bp    mRNA    linear   PLN 13-OCT-2017
DEFINITION  PREDICTED: Setaria italica uncharacterized LOC111256352
            (LOC111256352), mRNA.
ACCESSION   XM_022824234
VERSION     XM_022824234.1
DBLINK      BioProject: PRJNA207554
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Setaria italica (foxtail millet)
  ORGANISM  Setaria italica
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; PACMAD
            clade; Panicoideae; Panicodae; Paniceae; Cenchrinae; Setaria.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_028451.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Setaria italica Annotation Release
                                           103
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 100% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..576
                     /organism="Setaria italica"
                     /mol_type="mRNA"
                     /strain="Yugu1"
                     /db_xref="taxon:4555"
                     /chromosome="II"
     gene            1..576
                     /gene="LOC111256352"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 Protein"
                     /db_xref="GeneID:111256352"
     CDS             1..576
                     /gene="LOC111256352"
                     /codon_start=1
                     /product="uncharacterized protein LOC111256352"
                     /protein_id="XP_022679969.1"
                     /db_xref="GeneID:111256352"
                     /translation="
MDCPNTNPKRSEVTVTCPSDDAIVEILSRLPAKLRFRFKKFPQTLEGFFFGGSPYENYGHFVDLFGRPSPLVDASFSFLTGLPEIEKINLLGSCNGLLLFGHRRVSDMNDSLGYIVCNPATEQWVAVPSSGWTPSPLDDSACTYLIFDPAVSSHFQLVQFTQDDEGAILQFRRNADDNEVEGVAEVRTLLI"
ORIGIN      
atggattgccccaacaccaaccccaagaggagcgaggtcacggtgacctgcccctccgacgacgcaatcgtggagatcctctcgcgcctccccgccaagcttcgcttccggttcaagaaattcccccagactctagaagggttcttcttcggtggtagcccttatgagaactatgggcatttcgtcgatctgttcgggagaccctcgcccctcgtcgatgcttcgttctcgttcctcactggactgcctgagattgagaagatcaaccttttgggttcctgcaatgggctcctgctcttcgggcacagacgggtttcagacatgaatgactcactgggctatattgtgtgcaaccctgcgaccgagcaatgggtggccgttcccagctctggctggactccatctccattggacgattcggcctgcacctatttgatctttgacccggctgtctcctcgcactttcagttggtccagttcacgcaagatgatgagggagcgatactccaattcaggcgaaatgctgatgataatgaggttgagggagtggcagaggtgcggaccctactcatctga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]