LOCUS       XM_020806647            1819 bp    mRNA    linear   VRT 10-APR-2017
DEFINITION  PREDICTED: Pogona vitticeps vimentin (VIM), mRNA.
ACCESSION   XM_020806647
VERSION     XM_020806647.1
DBLINK      BioProject: PRJNA382134
KEYWORDS    RefSeq.
SOURCE      Pogona vitticeps (central bearded dragon)
  ORGANISM  Pogona vitticeps
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Lepidosauria; Squamata; Bifurcata; Unidentata; Episquamata;
            Toxicofera; Iguania; Acrodonta; Agamidae; Amphibolurinae; Pogona.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_018151138.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Pogona vitticeps Annotation Release
                                           100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1819
                     /organism="Pogona vitticeps"
                     /mol_type="mRNA"
                     /isolation_source="Queensland, 58 km west of Eulo on
                     Adventure Way"
                     /specimen_voucher="1003387339"
                     /db_xref="taxon:103695"
                     /chromosome="Unknown"
                     /sex="male"
                     /country="Australia"
                     /lat_lon="28.098 S 144.465 E"
                     /identified_by="D OMeally"
     gene            1..1819
                     /gene="VIM"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 67 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 30 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:110085989"
     CDS             116..1504
                     /gene="VIM"
                     /codon_start=1
                     /product="vimentin"
                     /protein_id="XP_020662306.1"
                     /db_xref="GeneID:110085989"
                     /translation="

MSTTTSTRSSYRRMFAGGSRPSTGGSSRYVTSSSRYSLGSAIRPSSVRLVSSSAPGGGIYASKSVRLRSSLPPVRLLADAGVDFSLADAINSEFKANRTNEKAELQELNDRFANYIDKVRFLEQQNKILLAELEQLKGKGTSRLGDLYEEEMRELRRQVDQLTNDKARVEVERDNLADDIMRLREKLQDEMLQREEAENTLQSFRQDVDNASLARLDLERKVESLQEEIVFLKKLHEEEIRELQAQLQEQHIQIDMDVAKPDLTAALRDVRQQYESVATKNLQEAEEWYKSKFADLSEAASRNNDALRQAKQEANEYRRQIQSLTCEVDALKGTNESLERQMREMEENFALEAANYQDTITRLQDEIQNMKEEMARHLREYQELLNVKMALDIEIATYRKLLEGEESRISMPIPTFASLNLRETNLESIPVDTHSKRTLLIKTVETRDGQVINETSHHDDLE"

     misc_feature    155..412
                     /gene="VIM"
                     /note="Intermediate filament head (DNA binding) region;
                     Region: Filament_head; pfam04732"
                     /db_xref="CDD:428095"
     misc_feature    413..1339
                     /gene="VIM"
                     /note="Intermediate filament protein; Region: Filament;
                     pfam00038"
                     /db_xref="CDD:425436"
ORIGIN      

cgagagtccggccagcgctctcccgcgcctcttcctcgtgtgctctctggccgtcgaagttcccgaagccgccgccgcctcctcaccccgggaccgtccggattagcccgccaagatgagcacgacgacctcgacccggtcttcttaccgccgcatgttcgcgggcggcagccggcccagcaccggcggcagctcccgttatgtcacgtcttcgagccgctactcgctgggcagcgccatccggccgagcagcgtccgcctggtctcgtcctcggcgcccggcggcggcatctacgcctccaagtcggtgcggttgcgcagcagcctgccgccggtgcgcctcttggccgacgccggggtggacttctcgctggccgacgccatcaattcggagttcaaggcgaaccgcaccaacgagaaggccgagctccaggagctcaacgaccgcttcgccaactacatcgacaaggtgcgcttcttggagcagcagaacaagatcctgctggccgagctcgagcagctgaagggcaaaggcacctcgcgcctgggcgacctctacgaggaggagatgcgcgaactccgtcgccaggtggaccagctcaccaacgacaaggcgcgcgtggaagtggagcgggacaacttggccgacgacatcatgcgcctccgagagaaacttcaagatgagatgcttcagagagaagaagctgaaaacactctgcagtctttcagacaggatgttgacaatgcctctttggctcgcctggatcttgaacgcaaagttgaatccctgcaagaagagattgtcttcttgaagaagcttcatgaggaggaaatccgtgagcttcaagcccaactccaggagcaacacatccagattgatatggatgttgccaagcctgatcttactgctgccctgcgcgatgtgcgccaacagtatgaaagtgttgctaccaagaaccttcaggaagctgaagagtggtacaaatctaaatttgcagatctctctgaagcagctagccggaacaatgatgcgctgcgccaggccaaacaagaagcgaatgagtaccgtaggcaaatccagtctctcacctgtgaagtggatgcccttaaaggaaccaatgaatccctggaacgccagatgcgtgagatggaggaaaactttgctcttgaagctgctaattaccaagacactattactcgtctccaagacgaaatccagaacatgaaggaagaaatggctcgccatcttcgcgagtaccaagaactcctgaatgtcaagatggctcttgatattgagattgccacttacaggaaactgctggaaggagaggagagcagaatttccatgcctattccgacctttgcttccctgaacctgagagaaacaaaccttgagtctattccagtggacacccactcaaagagaacactcctaatcaagactgttgaaactagagatggacaagttatcaatgagacttctcaccatgatgatctggagtgaagagagaacagcacatcttgaatttgaactcataccagcatgactaaaaagagaaacagccttcaagtgcctttctgcagtttcttccaagagcgcaaggtggttatgctagaagaaatagatcttagatcttgcaaagctgactctctctcgatggatctaggaaagcttaacaaaaaagggagtctagttaagataacaatatattgtgctgcaatactgttttttaagtttcttaattgaataaaatggctttttttttccagcacagtatgagcaacctcttactgcttcaataaacatttgggaaatggc

//