GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-11-21 21:54:32, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       XM_020393640            2276 bp    mRNA    linear   PLN 01-MAR-2017
DEFINITION  PREDICTED: Asparagus officinalis protein argonaute PNH1
            (LOC109826616), mRNA.
ACCESSION   XM_020393640
VERSION     XM_020393640.1
DBLINK      BioProject: PRJNA376608
KEYWORDS    RefSeq.
SOURCE      Asparagus officinalis (garden asparagus)
  ORGANISM  Asparagus officinalis
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Liliopsida; Asparagales;
            Asparagaceae; Asparagoideae; Asparagus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_033794.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Asparagus officinalis Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2276
                     /organism="Asparagus officinalis"
                     /mol_type="mRNA"
                     /db_xref="taxon:4686"
                     /chromosome="1"
                     /sex="male"
                     /tissue_type="Spear"
                     /dev_stage="Mature"
                     /geo_loc_name="Netherlands"
                     /genotype="DH0086"
     gene            1..2276
                     /gene="LOC109826616"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 8 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 20 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:109826616"
     CDS             1..1971
                     /gene="LOC109826616"
                     /codon_start=1
                     /product="protein argonaute PNH1"
                     /protein_id="XP_020249229.1"
                     /db_xref="GeneID:109826616"
                     /translation="
MSSTAFIEPLPVIEFVAQVLGKDVSLRTMSDADRVKIKKALRGVKVEVTHRGSVRRKYRVSGLTSLPTRELIFPVDEQNNMKSVVEYFKEMYGFTIQYSHLPCLQVGNQKKANYLPMEACKIVEGQRYTKRLNEKQITSLLKVTCQRPREQEMDILQTVHQNSYDQDPYAKEFGISISDKLASVEARVLPAPWLKYHETGKEKECLPQVGQWNMMNKKVINGCTVNHWACINFSRSIQESTAHGFCQELAQMCQITGMEFNRDPIIPIYNSRPEQVEKALKHVYNAAVNKSKGKELELLIAILPDNNGSLYGDLKRICETDLGLISQCCLTKHVFKISKQYLANVSLKINVKMGGRNTVLLDAISCRIPLVSDIPTIIFGADVTHPETGEDSSPSIAAVVASQDWPEVTKYAGLVCAQAHRQELIQDLYKTWQDPERGTVTGGMIRELLISFRKATGQKPMRIIFYRDGVSEGQFYQVLLYELDAIRKACASLEPNYQPPVTFVIVQKRHHTRLYANNHKDRSSTDRSGNILPGTVVDSKICHPTEFDFYLCSHAGIQGTSRPAHYHVLWDENNFTADEMQTLTNNLCYTYARCTRSVSVVPPAYYAHLAAFRARFYTEPEMPENQKSRSTRMANSSAVKPLPALKEKVKRVMFYC"
     misc_feature    25..369
                     /gene="LOC109826616"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(172..174,217..219,250..252,262..264,316..318,
                     337..339,343..345)
                     /gene="LOC109826616"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    502..1854
                     /gene="LOC109826616"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(931..933,943..945,979..990,997..999,1021..1023,
                     1030..1032,1042..1044,1054..1056)
                     /gene="LOC109826616"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1144..1146,1150..1152,1402..1404,1822..1824)
                     /gene="LOC109826616"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
atgtcgtctacagcattcatagaacccctgcctgtgatcgagtttgtagctcaagttttgggcaaagatgtgtccttaaggacgatgtctgatgctgatcgtgttaagatcaagaaggctcttagaggtgtaaaagttgaagtcactcatagaggaagcgtacgaaggaaatatcgagtttcaggattgacatctcttcctactagagagctgattttcccagttgacgaacaaaacaacatgaaatctgtggttgaatacttcaaagaaatgtatggctttacaattcaatattctcacctgccttgccttcaagtaggaaatcaaaagaaggcaaattatctgccaatggaggcatgtaaaatagttgaaggacagagatatacaaagagattgaatgaaaagcaaattacttccctgctaaaagttacctgccagaggcccagagaacaggagatggatatactgcagacagttcatcaaaatagttatgaccaagatccttatgcaaaggaatttggaatcagcatcagcgacaaacttgcctccgtcgaagctcgagttcttccagctccttggttaaaatatcatgaaactggaaaagaaaaggagtgtttgcctcaggttggacaatggaatatgatgaacaagaaagtaataaatggttgcactgtaaaccactgggcttgcatcaacttttcacgtagcattcaagaaagcactgctcatggattctgtcaagagctagctcagatgtgccaaataactggcatggaatttaacagagatcccataataccaatctacaattcaaggcctgaacaagtagagaaggcccttaagcatgtctataatgctgcagtgaacaaatcgaagggcaaggagctagaacttcttatagcaatccttcctgataacaatggttctctgtacggtgatctcaaaagaatatgtgaaacagatttgggtttgatatcccagtgctgcctgacaaaacatgtatttaagataagcaagcagtacctagcaaatgtatcgcttaaaattaatgtcaagatgggaggaagaaatactgtactcttagacgccattagttgtagaattcccttggtcagtgacataccgacgataatatttggagcagatgtaactcatccagagactggggaggattctagtccatctattgctgcggttgttgcctctcaagattggcctgaagttacaaaatacgctggattagtatgtgctcaggctcatcgacaggaactcattcaggatctatacaagacgtggcaggatcccgaacgggggacagttacaggaggcatgatcagggagcttctgatctccttcaggaaggctactggacaaaagccaatgaggattatcttttacagagacggcgttagtgaagggcaattctatcaggtcctgctatatgaattagatgccattcgtaaggcatgtgcatcattagagccaaactaccagcctccagttacctttgtcatagtccaaaagcgccatcacacgaggctgtacgcaaacaaccacaaagatagaagtagtactgacaggagtggaaacatcctaccagggacagtggttgattccaagatatgccatcctactgagtttgacttctacttatgcagtcatgctggaattcagggaactagtcggccagcacattaccatgttctatgggatgagaacaatttcactgcagatgagatgcaaacgctgacaaataacctatgctatacgtatgctcgctgtacccgttctgtttctgttgtgcctcctgcgtattatgctcatcttgctgcattccgagcacgattctacacagaaccagagatgcctgagaaccagaaatcacgaagcacaagaatggcaaacagttctgcggtgaagccactaccagcactaaaagagaaagtgaagagggtgatgttctactgctgatatcaacataagagaggtagaaaaaaccagtagcatgtacatgaatgtcgtgtttatattgtagagtttagttgatactaactctgtagacaatcttcaacctaatcgaggaatgcaagatcagaggagggatttgtttttgtcattctgtacctgatgccaggagataatgtatgccacaattcctgttcagttcttgtacaatgaaaaacttctgctaatttccgctgtaatagtgctgtatatattttgaactcatgtgaacaatgaatttctattcggtattgaatctgatttgtgttgaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]