LOCUS       XM_019746073            1883 bp    mRNA    linear   MAM 22-DEC-2016
DEFINITION  PREDICTED: Rhinolophus sinicus vimentin (VIM), mRNA.
ACCESSION   XM_019746073
VERSION     XM_019746073.1
DBLINK      BioProject: PRJNA358073
KEYWORDS    RefSeq.
SOURCE      Rhinolophus sinicus (Chinese rufous horseshoe bat)
  ORGANISM  Rhinolophus sinicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Chiroptera; Microchiroptera;
            Rhinolophidae; Rhinolophinae; Rhinolophus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_017739151.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Rhinolophus sinicus Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1883
                     /organism="Rhinolophus sinicus"
                     /mol_type="mRNA"
                     /isolate="Zhonghua_01"
                     /db_xref="taxon:89399"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="muscle"
     gene            1..1883
                     /gene="VIM"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 14 mRNAs, 26 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 13 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:109454905"
     CDS             162..1565
                     /gene="VIM"
                     /codon_start=1
                     /product="vimentin"
                     /protein_id="XP_019601632.1"
                     /db_xref="GeneID:109454905"
                     /translation="

MSTRSMTSSSYRRMFGGPGTASRPSSSRSYVTSSTRSYSLGSALRPSTSRSVYASAPGGMYATRSSAVRLRSSVPGLRLLQDSVDFSLADAINTEFKNTRTNEKVELQELNDRFANYIDKVRFLEQQNKILLAELEQLKGQGKSRLGDLYEEEMRELRRQVDQLTNDKARVEVERDNLAEDVMRLREKLQEEMLQREDAEGTLQSFRQDVDNASLARLDLERKVESLQEEIVFLKKLHDEEIGELQAQIQEQHVQIDVDVSKPDLTAALRDVRQQYESVAAKNLQEAEEWYKSKFADLSEAANRNNDALRQAKQESNEYRRQVQSLTCEVDALKGTNESLERQMREMEENFAVEAANYQDTIGRLQDEIQNMKEEMARHLREYQDLLNVKMALDIEIATYRKLLEGEESRISLPLPNFSSLNLRETNLVDSLPLVDTHSKRTLLIKTVETRDGQVINETSQHHDDLE"

     misc_feature    192..464
                     /gene="VIM"
                     /note="Intermediate filament head (DNA binding) region;
                     Region: Filament_head; pfam04732"
                     /db_xref="CDD:428095"
     misc_feature    465..1391
                     /gene="VIM"
                     /note="Intermediate filament protein; Region: Filament;
                     pfam00038"
                     /db_xref="CDD:425436"
ORIGIN      

tcggcggggtctcgtcctctgccactctcgctccagggtctccgcgcctgagacgcagcagcgttcccaccgcccacacccaccgcgcccttgctcgcctctctgcccggagccagtccgcgccgccacagccacccagcctattgccaccctccgcagccatgtccaccaggtccatgacctcgtcctcctaccgcaggatgttcggcggccccggcaccgccagccggccgagctccagccggagctacgtgacctcgtccacccgcagctacagtctgggcagcgctctgcgccccagcaccagccgcagcgtctacgcctccgcccccggcggtatgtacgctacgcgctcctcggcggtccgcctgcggagcagtgtcccgggcttgcggctgctgcaggactcggtggacttctcgctggctgacgccatcaacaccgagttcaagaacacccgcaccaacgagaaggtggagttgcaggagctgaatgatcgcttcgccaactacatcgacaaggtgcgcttcctggagcagcagaacaagatcctgctggccgagctcgagcagctcaagggccagggcaagtcgcgactgggggacctctacgaagaggagatgcgggagctgcgccggcaggtggaccagctcaccaacgacaaggcccgcgtcgaggtagagcgcgacaacctggccgaggacgtcatgcggctccgggagaaattgcaggaggagatgcttcagagagaggatgccgagggaaccctgcagtctttcagacaggatgttgacaatgcttctttggcacgtcttgaccttgagcgtaaagtggaatccttgcaagaagagattgtctttttgaagaaactgcatgatgaggaaatcggggagctgcaggctcagattcaggaacagcatgtccaaatcgatgtggatgtgtccaagcctgacctcacggctgccctgcgcgacgtacgtcagcagtacgaaagcgtggctgccaagaatcttcaggaggctgaagaatggtacaagtccaagtttgctgacctgtccgaggccgctaaccggaacaatgatgccctgcgccaggcaaagcaggagtcaaatgagtaccggagacaggtgcagtccctcacctgcgaagtggatgctcttaaaggaactaacgagtctctggaacgccagatgcgggaaatggaagagaactttgctgttgaagctgctaactatcaagacactatcggccgcctgcaggacgagattcagaacatgaaggaagaaatggctcgtcacctgcgtgaataccaggacctgctgaatgtcaagatggctctggacatcgagatcgccacctacaggaagctgctggaaggcgaggagagcaggatttcactgcctctgccaaacttttcttccctgaacctgagggaaaccaacctggtggattcgctccctctcgttgacacccactcaaaaaggacacttctgattaagacggttgaaactagagatggacaggttatcaatgaaacatctcagcatcatgacgatctggaatgaaaattgcacacactcaattcagcaatgtattaccagcaagaacaaaagagaaatccgtatcttaaagaaacagctttcaagtgcctttctgcagtttttcaggagcgcaagatagatttggaataggaataagctctagttcttaagaaccaacactcctaaactaaaagatgtagaaaaaagtttacaacataatctagtttacaaagaagccttgtgctagaatacttgttaaaaagtatttttgaatacctttaaaactgcttttttccaacctgaccaatttgattctgcttcaataaatctttggaaaactct

//