2024-11-21 22:32:04, GGRNA.v2 : RefSeq release 226 (Sep, 2024)
LOCUS XM_019528209 2736 bp mRNA linear VRT 16-DEC-2016 DEFINITION PREDICTED: Gavialis gangeticus argonaute 2, RISC catalytic component (AGO2), transcript variant X3, mRNA. ACCESSION XM_019528209 VERSION XM_019528209.1 DBLINK BioProject: PRJNA357062 KEYWORDS RefSeq. SOURCE Gavialis gangeticus (Gharial) ORGANISM Gavialis gangeticus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Crocodylia; Longirostres; Gavialidae; Gavialinae; Gavialis. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_017728992.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Gavialis gangeticus Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2736 /organism="Gavialis gangeticus" /mol_type="mRNA" /isolate="Ggan-Ray" /db_xref="taxon:94835" /chromosome="Unknown" /sex="female" /tissue_type="blood" gene 1..2736 /gene="AGO2" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 Protein, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 5 samples with support for all annotated introns" /db_xref="GeneID:109305223" CDS 66..2417 /gene="AGO2" /codon_start=1 /product="protein argonaute-2 isoform X3" /protein_id="XP_019383754.1" /db_xref="GeneID:109305223" /translation="
MVQHFKTQIFGDRKPVFDGRKNLYTAMALPIGREKQVELEVTLPGEGKDRIFKVAIKWMSCVSLQALHDALSGRLPSVPFETIQALDVVMRHLPSMRYTPVGRSFFTASEGCSNPLGGGREVWFGFHQSVRPSLWKMMLNIDVSATAFYKAQPVIEFVCEVLDFKSIEEQQKPLTDSQRVKFTKEIKGLKVEITHCGQMKRKYRVCNVTRRPASHQTFPLQQENGQTVECTVAQYFKDRHKLVLRYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIRATARSAPDRQEEISKLMRSASFNTDPYVREFGIMVKDEMTDVTGRVLQPPSILYGGRNKAIATPVQGVWDMRNKQFHTGIEIKVWAIACFAPQRQCTEVHLKSFTEQLRKISRDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYAGLQLVVVILPGKTPVYAEVKRVGDTVLGMATQCVQMKNVQRTTPQTLSNLCLKINVKLGGVNNILLPQGRPPVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPNRYCATVRVQQHRQEIIQDLAAMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFQQVLHHELLAIREACIKLEKDYQPGITFIVVQKRHHTRLFCTDKNERVGKSGNIPAGTTVDTKITHPSEFDFYLCSHAGIQGTSRPSHYHVLWDDNRFSSDELQILTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHTSGQSNGRDHQALAKAVQVHQDTLRTMYFA"
misc_feature 108..335 /gene="AGO2" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:465134" misc_feature 363..515 /gene="AGO2" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:462567" misc_feature 516..878 /gene="AGO2" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(672..674,717..719,759..761,771..773,825..827, 846..848,852..854) /gene="AGO2" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1011..2288 /gene="AGO2" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1422..1424,1434..1436,1470..1481,1488..1490, 1512..1514,1521..1523,1533..1535,1545..1547) /gene="AGO2" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(1626..1628,1632..1634,1842..1844,2256..2258) /gene="AGO2" /note="active site" /db_xref="CDD:240015" ORIGIN
atttgtctgtgctggtataagaggactttggagaaactaaatgtaacagagaaattgtggagcatatggttcagcactttaaaacacaaatctttggggatcgtaaaccagtatttgatggaagaaaaaatctttatacagctatggcgcttcctatcgggagggagaaacaggtggagttggaggtcacactgccaggagaagggaaggacaggatatttaaagtggctatcaaatggatgtcctgcgtgagtctgcaggctttacatgatgctctttctggtcggctgccaagtgttcctttcgaaaccatccaggcattggatgttgtgatgaggcatttgccttccatgaggtatacccctgtggggaggtctttttttactgcctctgaagggtgctcaaatcctctgggtggtggcagagaagtttggtttggattccatcaatcagtcagaccttcactgtggaaaatgatgcttaacattgatgtgtctgcaacagcattttacaaggcacagccagtaattgagtttgtatgtgaagttttggatttcaaaagtattgaagagcaacagaaacctctgacagattcccaaagggtaaagtttaccaaagaaataaaaggtctaaaggtggagataacacactgtggacaaatgaagagaaaatacagagtatgcaatgtcaccagacgaccagcaagtcaccaaacattcccacttcagcaggagaatggacaaacagttgaatgcactgtggctcagtattttaaggataggcacaagctggttctgcgctatcctcatcttccatgtttacaagttggacaggagcagaaacacacataccttcctcttgaggtgtgcaacatagtggcaggacagagatgtataaagaaactgacagacaatcagacttccactatgatacgtgcaacagcaagatcagcacctgaccgccaagaagagataagcaaattgatgcgaagtgcaagttttaatactgatccttacgttcgtgaatttggaataatggtcaaagatgaaatgactgatgtgactggtagagtcctgcaacctccttcaatcctttatggaggcagaaataaagcaattgctaccccagttcaaggagtctgggatatgaggaataaacagtttcacactggaattgaaatcaaggtttgggcaattgcctgctttgctccccaacgccaatgcactgaagttcatcttaagtcttttacagaacaactgaggaagatatcaagagatgcaggaatgccaatccaggggcagccatgtttttgcaaatatgcccagggagcagatagcgtggaacccatgttcagacatctgaagaacacctatgctgggttacagcttgttgtagtcattttaccagggaaaactccagtttatgcggaagtaaagcgtgttggtgatactgtactggggatggctacccagtgtgttcagatgaaaaatgtgcaaagaacaacaccgcaaactttgtccaatctttgtttaaagatcaacgtcaaattaggaggagtaaataacattttactgccacagggaaggccaccagtgtttcagcagcctgttatattccttggtgcagatgtcactcatccaccagctggagatggaaaaaagccttccattgctgcagtcgttggtagtatggatgctcacccaaatcgatactgtgccactgttcgtgtccagcagcaccgtcaagaaatcatccaggatttggctgccatggtcagggagttacttattcagttctacaaatcaaccagatttaaaccaactcgcattattttctacagagatggcgtttctgaggggcagtttcaacaggttctccatcatgaactgttggctatcagagaagcatgcattaaattagaaaaggactaccagccaggaattacatttattgttgtgcagaaaaggcatcacacaagactcttctgtacagacaaaaatgaacgggttggaaaaagtggaaacattcctgcaggtactacagtggacacaaaaatcacccatccatcagaatttgacttttacctgtgtagtcatgctggtattcagggaacaagcagaccttctcattaccatgtcctctgggatgacaatcgtttctcttcggatgaactgcagattctcacctaccagctgtgtcatacgtatgtacgctgtactcgttccgtctccatccctgcaccagcatactatgcacacctggttgccttcagagccaggtatcatctggtggataaagaacatgatagtgctgaaggaagccacacatctggtcagagtaatggcagagatcatcaagcacttgctaaagcagttcaagttcaccaagacacattacgtaccatgtactttgcttgacatgttttaatgtttagcgattcagtagagttggattcacatgagaccagctgcacttagactaacagttgcccaagctacactgacagccagcaatgagtgatgcatctgtattttattttttccattttcaagaaggccttccgtccagaatttctgacttgatttctgaactacagacttgtacaaaacctcacaattgttggaaatgtggtttgccaaatctttaagctgcttgtcagaaaacagacccaggttttacagctgtgatcaaaagctgtgatctcagggctagaaatgaaacaaaattcatcattta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]