2024-05-02 12:15:27, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_019512210 2458 bp mRNA linear VRT 16-DEC-2016 DEFINITION PREDICTED: Gavialis gangeticus protein argonaute-1 (LOC109294022), transcript variant X3, mRNA. ACCESSION XM_019512210 VERSION XM_019512210.1 DBLINK BioProject: PRJNA357062 KEYWORDS RefSeq. SOURCE Gavialis gangeticus (Gharial) ORGANISM Gavialis gangeticus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Crocodylia; Longirostres; Gavialidae; Gavialinae; Gavialis. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_017729015.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Gavialis gangeticus Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2458 /organism="Gavialis gangeticus" /mol_type="mRNA" /isolate="Ggan-Ray" /db_xref="taxon:94835" /chromosome="Unknown" /sex="female" /tissue_type="blood" gene 1..2458 /gene="LOC109294022" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 4 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 7 samples with support for all annotated introns" /db_xref="GeneID:109294022" CDS 65..2359 /gene="LOC109294022" /codon_start=1 /product="protein argonaute-1 isoform X3" /protein_id="XP_019367755.1" /db_xref="GeneID:109294022" /translation="
MEAGPSGAAAGAYLPPLQQVFQAPRRPGIGTVGKPIKLLANYFEVDIPKIDVYHYEVDIKPDKCPRRVNREVVEYMVQHFKPQIFGDRKPVYDGKKNIYTVTALPIGNERVDFEVTIPGEGKDRIFKVSIKWMAIVSWRMLHEALVSGQIPVPLESVQALDVAMRHLASMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIEFMCEVLDIRNIDEQPKPLTDSQRVRFTKEIKGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLESGQTVECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLMKNASYNLDPYIQEFGIKVKDDMTEVTGRVLPAPILQYGGRNRAIATPNQGVWDMRGKQFYNGIEIKVWAIACFAPQKQCREEVLKNFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINVKLGGINNILVPHQRSAVFQQPVIFLGADVTHPPAGDGKKPSITAVVGSMDAHPSRYCATVRVQRPRQEIIEDLSYMVRELLIQFYKSTRFKPTRIIFYRDGVPEGQLPQILHYELLAIRDACIKLEKDYQPGITYIVVQKRHHTRLFCADKNERIGKSGNIPAGTTVDTNITHPFEFDFYLCSHAGIQTFPLLRPLG"
misc_feature 164..556 /gene="LOC109294022" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:435368" misc_feature 584..736 /gene="LOC109294022" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:430160" misc_feature 737..1099 /gene="LOC109294022" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(893..895,938..940,980..982,992..994,1046..1048, 1067..1069,1073..1075) /gene="LOC109294022" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1232..2329 /gene="LOC109294022" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1643..1645,1655..1657,1691..1702,1709..1711, 1733..1735,1742..1744,1754..1756,1766..1768) /gene="LOC109294022" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" ORIGIN
ggtgtcggtgcggccgtctccgccccgcgctcagccaggctcggccgctgcccgggtggatgggatggaagcaggaccctcgggagcagctgcgggcgcttacctgccacccttacagcaggtatttcaagcaccacgccggcccgggataggaactgtcgggaagcccatcaaactcttggccaactactttgaagtggacattcccaagatcgatgtctatcactatgaagtggatatcaaacccgacaaatgtccgcgcagagtcaacagggaggtggtggaatatatggtacaacacttcaaacctcagatcttcggtgaccgcaagccagtatacgatgggaagaaaaacatttacactgtcactgctttgcccattggaaatgaacgggttgactttgaggtaacaattccgggagaaggcaaggacaggatcttcaaggtttccataaagtggatggcaatcgtgagctggcggatgctgcatgaagccctagtgagcgggcagatccccgtccctctggaatcggtccaggcactggatgtggccatgcgccatctggcttcaatgaggtacactcctgtgggccgctcctttttctctcctccggaaggttactaccacccccttggtgggggcagggaggtttggtttggattccatcagtccgtcaggcctgccatgtggaagatgatgctcaacattgatgtgtcggcaacggctttctacaaagcccagcctgtgattgagttcatgtgcgaagtactggacatccggaacattgacgagcagccgaagcccctgacagattcacagagggtgcgcttcactaaggagatcaaaggtttgaaagtagaggtgacccactgtggacagatgaagaggaaataccgtgtgtgtaacgttaccaggcgaccagccagtcaccaaacgttccccctgcagctggagagtggccagacggtggagtgcacagtggctcagtacttcaagcagaaatacaacctgcagctgaaatacccccacctaccctgtctgcaggttggccaggaacagaagcacacatatctgcccctggaggtgtgtaacattgtggcaggccagcgctgcatcaagaagctaacagacaatcagacgtcaaccatgataaaggcaacagcaaggtctgccccagacaggcaagaggaaattagccgcctgatgaaaaatgccagttacaacctagatccgtacatacaggagtttgggataaaggtgaaggatgacatgacggaggtgaccgggagggtccttcctgcgccaatcctacagtatggaggacggaaccgggcgatcgccactcccaaccagggcgtgtgggatatgcgcgggaagcagttctacaacggcattgagatcaaagtgtgggccatcgcatgctttgcccctcagaagcagtgtcgagaagaggtgctgaagaacttcacagaccagctgcgcaagatatccaaggatgcagggatgccaatccagggacagccatgcttctgtaaatatgcccagggcgcagacagtgtggagcccatgttccgacacctcaaaaacacctactcagggctccagctcatcattgtcatcctaccagggaaaacaccggtgtatgcggaggtaaagcgtgtgggggacacactcctggggatggccacacagtgcgttcaggtcaagaacgtagtgaagacctctccacagaccctctccaatctctgcctcaagatcaatgtcaagttgggtggaatcaacaacatccttgtgcctcatcagcgctcagccgtctttcagcagccagtgatcttcctcggagctgatgtcactcacccaccagcaggagatgggaagaagccttccatcacagccgttgtgggcagcatggatgcccacccaagccgttactgtgccacagtgcgtgtgcagcgaccgcgacaggagattattgaggacttgtcatacatggtgagggaacttcttatccagttctacaagtccacccgcttcaagcccaccaggatcatcttctatcgggacggggttcccgaggggcagctcccacagattcttcactacgagcttctggcaatccgggatgcctgcatcaaactggaaaaggattatcagcctggcatcacctacatagttgtccagaaacggcaccacacccgccttttctgtgcagacaagaacgagaggattggcaagagtggcaacatcccggcaggaacaactgtggataccaacatcacccacccatttgaattcgacttctacctttgcagtcatgcaggcattcagaccttcccattactacgtcctctgggatgacaaccggtttacagcagatgagctgcagatcctcacgtaccagctctgtcacacctatgtgcggtgcacccgctctgtctccatcccggcaccagcata
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]