2024-11-23 18:26:37, GGRNA.v2 : RefSeq release 226 (Sep, 2024)
LOCUS XM_018563609 2797 bp mRNA linear VRT 30-SEP-2016 DEFINITION PREDICTED: Nanorana parkeri argonaute 2, RISC catalytic component (AGO2), mRNA. ACCESSION XM_018563609 VERSION XM_018563609.1 DBLINK BioProject: PRJNA344660 KEYWORDS RefSeq. SOURCE Nanorana parkeri ORGANISM Nanorana parkeri Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Amphibia; Batrachia; Anura; Neobatrachia; Ranoidea; Dicroglossidae; Dicroglossinae; Nanorana. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_017306948.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Nanorana parkeri Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2797 /organism="Nanorana parkeri" /mol_type="mRNA" /isolate="BGI_ZX_2015" /isolation_source="muscle sample" /db_xref="taxon:125878" /chromosome="Unknown" /sex="female" /geo_loc_name="China" /collection_date="Aug-2012" gene 1..2797 /gene="AGO2" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 35 Proteins, and 96% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:108792766" CDS 75..2651 /gene="AGO2" /codon_start=1 /product="protein argonaute-2" /protein_id="XP_018419111.1" /db_xref="GeneID:108792766" /translation="
MYSGAGPVLAPPPPPPLPEYTFKPPSRPDFGTSGRTIKLQANFFEMEIPKIEIYHYEIDIKPEKCPRRVNREIVEHMVLHFKAQIFGDRKPVFDGRKNLYTAMPLPIARDKVELEVTLPGEGKDRIFKVAIKWMACVSLQALHDALSGRLPSVPFETIQALDVVMRHLPSMRYTPVGRSFFTASEGCANPLGGGREVWFGFHQSVRPSLWKMMLNIDVSATAFYKAQPVIEFMCEVLDFKSIEEQQKPLTDSQRVKFTKEIKGLKVEITHCGQMKRKYRVCNVTRRPASHQTFPLQQESGQTVECTVAQYFKDRHKLVLRYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIRATARSAPDRQEEISKLMRSASFNTDPFVREFGIMVKDDMTDVTGRVLQPPSILYGGRNKAIATPVQGVWDMRNKQFHTGIEIKVWAIACFAPQRQCTELHLKTFTEQLRKISRDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYTGLQLIVVILPGKTPVYAEVKRVGDTVLGMATQCVQMKNVQRTTPQTLSNLCLKINVKLGGVNNILLPQGRPPVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPNRYCATVRVQQHRQEIIQDLAAMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFQQVLHHELLAIREACIKLEKDYQPGITFIVVQKRHHTRLFCTDRNERVGKSGNIPAGTTVDTKITHPSEFDFYLCSHAGIQGTSRPSHYHVLWDDNRFTSDELQILTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHTSGQSNGRDQQALAKAVQVHQDTLRTMYFA"
misc_feature 312..569 /gene="AGO2" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:465134" misc_feature 597..749 /gene="AGO2" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:462567" misc_feature 750..1112 /gene="AGO2" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(906..908,951..953,993..995,1005..1007,1059..1061, 1080..1082,1086..1088) /gene="AGO2" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1245..2522 /gene="AGO2" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1656..1658,1668..1670,1704..1715,1722..1724, 1746..1748,1755..1757,1767..1769,1779..1781) /gene="AGO2" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(1860..1862,1866..1868,2076..2078,2490..2492) /gene="AGO2" /note="active site" /db_xref="CDD:240015" ORIGIN
ccattgtcgccctcgcgggatagcgagtctgcgtgtgtccttcggcttagctcgtgaccgcccaaaccagcaccatgtactccggagccggccctgtgcttgcaccgccgccgccgccccccctgccggagtatactttcaagcctccatctagacctgattttggcacctcagggaggaccatcaagctgcaggcgaacttctttgagatggaaattcccaaaatagagatttatcattatgaaatagatatcaagccagaaaaatgtcccaggagggtaaacagggaaatagttgaacacatggtcctgcatttcaaggctcagatctttggagatcgtaaaccagtatttgatggcagaaagaacctctacactgcaatgcctcttccaattgccagagacaaagtggagttggaagtgacactgcccggggaaggaaaggatcgcatcttcaaagttgccattaagtggatggcttgcgtcagcttgcaggctctacacgatgcattgtctggacggcttcccagcgtcccttttgagactatacaggcgttagatgttgtgatgagacatttaccctctatgaggtatactcctgtaggtcgttctttttttactgcatccgaaggatgtgctaatcctcttggtggaggtagagaagtttggtttggcttccaccaatctgtcagaccttcactctggaaaatgatgctcaacatagatgtatctgctacagcgttttataaagcacaaccggtcatcgagttcatgtgtgaagttttggattttaaaagcatagaagagcaacaaaaacctctcacagattcccaaagggttaagtttaccaaagaaattaaaggcttaaaagtagaaattacacactgtggacaaatgaagagaaaatacagagtgtgcaatgtaacaaggcgaccagcaagtcatcaaacattccctctccagcaagagagcgggcaaacggtggaatgtaccgttgcacagtacttcaaggatagacacaaactagtacttcgctaccctcatcttccatgtttacaggtcgggcaggagcagaaacacacatacctccctctcgaggtatgcaatatagtggcaggacaaaggtgcataaagaaactgacagacaatcaaacctccactatgataagagccactgcccgctcagctccagaccgccaagaagagatcagtaaattgatgcgcagtgcaagttttaatactgatccgtttgtacgggaatttggtattatggtaaaagatgacatgacagatgtaaccggaagagtcctacaacctccttcaatcctatacggaggcaggaataaggccattgccacccctgtccagggtgtgtgggatatgaggaataaacagttccacactggcattgaaattaaagtgtgggcgatagcttgctttgctcctcagcggcaatgtacggaacttcacctcaaaactttcactgaacagttgcggaagatctctcgcgatgcaggaatgcccattcaggggcagccatgtttttgcaaatatgctcaaggagcagacagtgtggagcccatgttcaggcatctgaagaacacctatactggcctacagctgattgttgtaattctccccggaaagacccctgtgtatgcggaggtaaaacgtgtgggagacactgtgctgggcatggcgacgcagtgtgtgcagatgaaaaatgtacagagaactacaccgcagactctgtctaacctctgcctgaagattaatgtcaagttaggaggcgtcaataacattttgttaccccagggcaggcccccggtcttccagcagccggttatattcctcggagcggatgttactcatcctcctgcaggggatggaaaaaagccatcgattgcagcagttgtaggtagcatggacgcacaccccaaccgctattgtgccactgtaagggtgcagcagcacagacaggagatcatccaagatttggctgccatggtccgagaactgcttatccagttttacaagtcaacacgtttcaagcccacacggatcatcttctacagggatggggtttctgaaggacagttccagcaggtgttacatcatgagctattggcaattagggaagcctgtatcaagttggaaaaggattatcagcccggcattacctttatcgttgtacagaaaagacatcacacgcgacttttctgcacggacagaaatgagcgggtggggaaaagtggaaatattccagctggtacgacagtggacacaaaaatcacccacccgtcggagtttgatttttacctgtgcagccatgctggtattcagggaacaagcaggccctcacattatcatgtcctttgggatgacaaccggtttacttctgatgagctgcaaatcctcacttaccagctctgtcacacttatgtccgctgcactcgatctgtgtctatccctgccccagcctactacgcacacttagtcgcatttagagcccggtatcaccttgtggataaagagcatgacagcgctgaaggcagccacacttctggtcagagcaacgggagagatcaacaagcacttgctaaggcagttcaggttcaccaggacacactgcgtacaatgtactttgcttaactggtgctggtacccagatcttataggcactaaccaaggaggattcacgccagaccagctgcacttacttgtattgtagtccgcactacagtgacatccaagtgcaatctaccacaaccctatctttatcattatcccttgatcac
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]