2024-04-26 05:10:09, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_075237 108 bp rRNA linear BCT 02-FEB-2015 DEFINITION Porphyromonas gingivalis ATCC 33277 strain ATCC 33277 5S ribosomal RNA, complete sequence. ACCESSION NR_075237 VERSION NR_075237.1 DBLINK Project: 188106 BioProject: PRJNA188106 KEYWORDS RefSeq. SOURCE Porphyromonas gingivalis ATCC 33277 ORGANISM Porphyromonas gingivalis ATCC 33277 Bacteria; Bacteroidota; Bacteroidia; Bacteroidales; Porphyromonadaceae; Porphyromonas. REFERENCE 1 AUTHORS Naito,M., Hirakawa,H., Yamashita,A., Ohara,N., Shoji,M., Yukitake,H., Nakayama,K., Toh,H., Yoshimura,F., Kuhara,S., Hattori,M., Hayashi,T. and Nakayama,K. TITLE Determination of the genome sequence of Porphyromonas gingivalis strain ATCC 33277 and genomic comparison with strain W83 revealed extensive genome rearrangements in P. gingivalis JOURNAL DNA Res. 15 (4), 215-225 (2008) PUBMED 18524787 REFERENCE 2 (bases 1 to 108) CONSRTM NCBI RefSeq Targeted Loci Project TITLE Direct Submission JOURNAL Submitted (14-FEB-2013) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 108) AUTHORS Hattori,M., Yamashita,A., Toh,H., Oshima,K. and Shiba,T. TITLE Direct Submission JOURNAL Submitted (10-APR-2007) Contact:Masahira Hattori University of Tokyo, Graduate School of Frontier Sciences; 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8562, Japan URL :http://www.cb.k.u-tokyo.ac.jp/hattorilab/ COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence is identical to AP009380:234597-234704. COMPLETENESS: full length. FEATURES Location/Qualifiers source 1..108 /organism="Porphyromonas gingivalis ATCC 33277" /mol_type="rRNA" /strain="ATCC 33277" /type_material="type strain of Bacteroides gingivalis" /db_xref="taxon:431947" /note="type strain of Porphyromonas gingivalis ATCC 33277" rRNA 1..108 /product="5S ribosomal RNA" ORIGIN
tcaggtggttataacgttggggatccacctcttcccattccgaacagagaagttaagcccaacggtgccgatggtactgcgtcacagtgggagagtaggacgccgccg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]