GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-10-05 21:20:39, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NR_039760                 76 bp    RNA     linear   PRI 02-SEP-2020
DEFINITION  Homo sapiens microRNA 378i (MIR378I), microRNA.
ACCESSION   NR_039760
VERSION     NR_039760.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 76)
  AUTHORS   Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi
            S, Kawano M, Matsushita S, Ochiya T and Miyajima A.
  TITLE     Identification of the novel 3' UTR sequences of human IL-21 mRNA as
            potential targets of miRNAs
  JOURNAL   Sci Rep 7 (1), 7780 (2017)
   PUBMED   28798470
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 76)
  AUTHORS   Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY,
            Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP,
            Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI,
            Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Liu Q,
            How T, Grubor V, Gao Y, Patel A, Wu H, Zhu J, Blobe GC, Lipsky PE,
            Chadburn A and Dave SS.
  CONSRTM   Hematologic Malignancies Research Consortium
  TITLE     Deep sequencing of the small RNA transcriptome of normal and
            malignant human B cells identifies hundreds of novel microRNAs
  JOURNAL   Blood 116 (23), e118-e127 (2010)
   PUBMED   20733160
REFERENCE   3  (bases 1 to 76)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res. 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from Z99716.4.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-76                Z99716.4           66462-66537         c
FEATURES             Location/Qualifiers
     source          1..76
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="22"
                     /map="22q13.2"
     gene            1..76
                     /gene="MIR378I"
                     /note="microRNA 378i"
                     /db_xref="GeneID:100616259"
                     /db_xref="HGNC:HGNC:41620"
                     /db_xref="miRBase:MI0016902"
     precursor_RNA   1..76
                     /gene="MIR378I"
                     /product="microRNA 378i"
                     /db_xref="GeneID:100616259"
                     /db_xref="HGNC:HGNC:41620"
                     /db_xref="miRBase:MI0016902"
     exon            1..76
                     /gene="MIR378I"
                     /inference="alignment:Splign:2.1.0"
     variation       1..3
                     /gene="MIR378I"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1602371689"
     variation       1
                     /gene="MIR378I"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1004020155"
     variation       2
                     /gene="MIR378I"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2077614202"
     variation       5
                     /gene="MIR378I"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2077614179"
     ncRNA           7..27
                     /ncRNA_class="miRNA"
                     /gene="MIR378I"
                     /product="hsa-miR-378i"
                     /db_xref="miRBase:MIMAT0019074"
                     /db_xref="GeneID:100616259"
                     /db_xref="HGNC:HGNC:41620"
                     /db_xref="miRBase:MI0016902"
     variation       7
                     /gene="MIR378I"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1000232273"
     variation       10
                     /gene="MIR378I"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168798678"
     variation       11
                     /gene="MIR378I"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:559716193"
     variation       13
                     /gene="MIR378I"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2518788260"
     variation       14
                     /gene="MIR378I"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1412213694"
     variation       22
                     /gene="MIR378I"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751026158"
     variation       25
                     /gene="MIR378I"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1332921079"
     variation       26
                     /gene="MIR378I"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:9607855"
     variation       27
                     /gene="MIR378I"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2077614083"
     variation       33
                     /gene="MIR378I"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:111400080"
     variation       35
                     /gene="MIR378I"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1268977737"
     variation       41
                     /gene="MIR378I"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2146586481"
     variation       42
                     /gene="MIR378I"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1264717180"
     variation       44
                     /gene="MIR378I"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2518788248"
     variation       49
                     /gene="MIR378I"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2146586474"
     variation       50
                     /gene="MIR378I"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2146586471"
     variation       55
                     /gene="MIR378I"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1229639290"
     variation       56
                     /gene="MIR378I"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2077614029"
     variation       57
                     /gene="MIR378I"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2077614020"
     variation       61
                     /gene="MIR378I"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:915573432"
     variation       65
                     /gene="MIR378I"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1056940896"
     variation       66
                     /gene="MIR378I"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:938433914"
     variation       67
                     /gene="MIR378I"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2518788235"
     variation       69
                     /gene="MIR378I"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1221661296"
     variation       70
                     /gene="MIR378I"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1346007902"
     variation       76
                     /gene="MIR378I"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2518788228"
ORIGIN      
gggagcactggactaggagtcagaaggtggagttctgggtgctgttttcccactcttgggccctgggcatgttctg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]