GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-10-05 21:20:53, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NR_030428                 76 bp    RNA     linear   ROD 06-AUG-2023
DEFINITION  Mus musculus microRNA 762 (Mir762), microRNA.
ACCESSION   NR_030428
VERSION     NR_030428.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 76)
  AUTHORS   Wang C, Chen Y, Cheng NT, Yang ZT, Tang HX and Xu M.
  TITLE     MicroRNA-762 Modulates Lipopolysaccharide-induced Acute Lung Injury
            via SIRT7
  JOURNAL   Immunol Invest 51 (5), 1407-1422 (2022)
   PUBMED   34251977
  REMARK    GeneRIF: MicroRNA-762 Modulates Lipopolysaccharide-induced Acute
            Lung Injury via SIRT7.
REFERENCE   2  (bases 1 to 76)
  AUTHORS   Khan A, Yuewen W, Dil S, Shah W, Shi Q and Khan R.
  TITLE     The evolutionarily conserved gene, Fam114a2, is dispensable for
            fertility in mouse
  JOURNAL   Reprod Biol 21 (3), 100531 (2021)
   PUBMED   34315090
  REMARK    GeneRIF: The evolutionarily conserved gene, Fam114a2, is
            dispensable for fertility in mouse.
REFERENCE   3  (bases 1 to 76)
  AUTHORS   Lai PS, Chang WM, Chen YY, Lin YF, Liao HF and Chen CY.
  TITLE     Circulating microRNA-762 upregulation in colorectal cancer may be
            accompanied by Wnt-1/beta-catenin signaling
  JOURNAL   Cancer Biomark 32 (2), 111-122 (2021)
   PUBMED   34092606
  REMARK    GeneRIF: Circulating microRNA-762 upregulation in colorectal cancer
            may be accompanied by Wnt-1/beta-catenin signaling.
REFERENCE   4  (bases 1 to 76)
  AUTHORS   Gao H, Ni N, Zhang D, Wang Y, Tang Z, Sun N, Ju Y, Dai X, Zhang Y,
            Liu Y and Gu P.
  TITLE     miR-762 regulates the proliferation and differentiation of retinal
            progenitor cells by targeting NPDC1
  JOURNAL   Cell Cycle 19 (14), 1754-1767 (2020)
   PUBMED   32544377
  REMARK    GeneRIF: miR-762 regulates the proliferation and differentiation of
            retinal progenitor cells by targeting NPDC1.
REFERENCE   5  (bases 1 to 76)
  AUTHORS   Qiang Z, Jin B, Peng Y, Zhang Y, Wang J, Chen C, Wang X and Liu F.
  TITLE     miR-762 modulates thyroxine-induced cardiomyocyte hypertrophy by
            inhibiting Beclin-1
  JOURNAL   Endocrine 66 (3), 585-595 (2019)
   PUBMED   31522342
  REMARK    GeneRIF: modulates thyroxine-induced cardiomyocyte hypertrophy by
            inhibiting Beclin-1
            Erratum:[Endocrine. 2020 Feb;67(2):503-505. PMID: 31939092]
REFERENCE   6  (bases 1 to 76)
  AUTHORS   Pogribny IP, Starlard-Davenport A, Tryndyak VP, Han T, Ross SA,
            Rusyn I and Beland FA.
  TITLE     Difference in expression of hepatic microRNAs miR-29c, miR-34a,
            miR-155, and miR-200b is associated with strain-specific
            susceptibility to dietary nonalcoholic steatohepatitis in mice
  JOURNAL   Lab Invest 90 (10), 1437-1446 (2010)
   PUBMED   20548288
REFERENCE   7  (bases 1 to 76)
  AUTHORS   Aoi W, Naito Y, Mizushima K, Takanami Y, Kawai Y, Ichikawa H and
            Yoshikawa T.
  TITLE     The microRNA miR-696 regulates PGC-1{alpha} in mouse skeletal
            muscle in response to physical activity
  JOURNAL   Am J Physiol Endocrinol Metab 298 (4), E799-E806 (2010)
   PUBMED   20086200
REFERENCE   8  (bases 1 to 76)
  AUTHORS   van Rooij E, Sutherland LB, Thatcher JE, DiMaio JM, Naseem RH,
            Marshall WS, Hill JA and Olson EN.
  TITLE     Dysregulation of microRNAs after myocardial infarction reveals a
            role of miR-29 in cardiac fibrosis
  JOURNAL   Proc Natl Acad Sci U S A 105 (35), 13027-13032 (2008)
   PUBMED   18723672
REFERENCE   9  (bases 1 to 76)
  AUTHORS   Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L,
            Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van
            Zonneveld AJ, Mano H, Plasterk R and Cuppen E.
  TITLE     Many novel mammalian microRNA candidates identified by extensive
            cloning and RAKE analysis
  JOURNAL   Genome Res 16 (10), 1289-1298 (2006)
   PUBMED   16954537
REFERENCE   10 (bases 1 to 76)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AC124507.4.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript is intronless :: SRR7345562.1695843.1,
                                        SRR7652917.971371.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-76                AC124507.4         169107-169182
FEATURES             Location/Qualifiers
     source          1..76
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="7"
                     /map="7 69.68 cM"
     gene            1..76
                     /gene="Mir762"
                     /gene_synonym="mir-762; Mirn762; mmu-mir-762"
                     /note="microRNA 762"
                     /db_xref="GeneID:791073"
                     /db_xref="MGI:MGI:3691607"
                     /db_xref="miRBase:MI0004215"
     precursor_RNA   1..76
                     /gene="Mir762"
                     /gene_synonym="mir-762; Mirn762; mmu-mir-762"
                     /product="microRNA 762"
                     /db_xref="GeneID:791073"
                     /db_xref="MGI:MGI:3691607"
                     /db_xref="miRBase:MI0004215"
     exon            1..76
                     /gene="Mir762"
                     /gene_synonym="mir-762; Mirn762; mmu-mir-762"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           48..69
                     /ncRNA_class="miRNA"
                     /gene="Mir762"
                     /gene_synonym="mir-762; Mirn762; mmu-mir-762"
                     /product="mmu-miR-762"
                     /db_xref="miRBase:MIMAT0003892"
                     /db_xref="GeneID:791073"
                     /db_xref="MGI:MGI:3691607"
                     /db_xref="miRBase:MI0004215"
ORIGIN      
gcccggctccgggtctcggcccgcacggtccggccggccatgctggcggggctggggccgggacagagcccgtggc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]